Busch Lab

ZMP

kirrel3l

Ensembl ID:
ENSDARG00000019473
ZFIN IDs:
ZDB-GENE-070831-1, ZDB-GENE-070831-1
Description:
kin of IRRE like 3 like [Source:RefSeq peptide;Acc:NP_001092814]
Human Orthologues:
KIRREL, KIRREL3
Human Descriptions:
kin of IRRE like (Drosophila) [Source:HGNC Symbol;Acc:15734]
kin of IRRE like 3 (Drosophila) [Source:HGNC Symbol;Acc:23204]
Mouse Orthologues:
Kirrel, Kirrel3
Mouse Descriptions:
kin of IRRE like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1891396]
kin of IRRE like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1914953]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30326
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045399 Essential Splice Site 502 769 12 15
ENSDART00000113050 Essential Splice Site 488 755 12 15
ENSDART00000125405 Essential Splice Site 487 754 12 15
Genomic Location (Zv9):
Chromosome Zv9_scaffold3455 (position 353743)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37109489
GRCz11 15 37011103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGCTAAATAGATTCAATCCTGCTTAGTCACGTTCTTTATTCCCCTTGC[A/T]GAAGCCCTCCCCTTGCTGATCATCATTGGAGCATCGGTGGGCGGAGGCTG
Long Flanking Sequence:
TTTAAGACTTTTTAAGACCCCGCAGATACCCTGAAAAATAATTCAATAAAATTAATAAATGTTAAGGTCACAAATGGTACAATTTCTTAGACCTGAATGTTTTTAAAAATCATTATACAATCACAAGAATCAAAAACACATGCAAATAATAAATTATAATACAAACTTAACATTGAAAATCTTGCAATGTGACTATTGTGGATGGTCACATTGTGATATCCATGCTGAAATGATATATTGTGCAGCCCTAATACCAAAACAGATAATAAATCACTTCAAATGATGAAAAACATCAATAAAAGTCACTTTTTCCAACATCAAAAATTATCGGAGGAAAGATCAAGGTCTCATCAAGAGTACCCATGAATCACGAAATACAGAAAACTGTTAACTTCTGAATAGATTTAAATGTGTAACTGTGTGTCAAAAAAACATATTCAACTTTTCACTGTAGCTAAATAGATTCAATCCTGCTTAGTCACGTTCTTTATTCCCCTTGC[A/T]GAAGCCCTCCCCTTGCTGATCATCATTGGAGCATCGGTGGGCGGAGGCTGTGTGTTCATCGTTTGTGTCATTACCCTGGTTTCCATCTGCTGCCGCCACAATGCTAAAGGTGAGGCCAAAGGTCAGATGTTATCTGAGAGTTCTTATTCTCTCCTCAAAAAAAACATGATACAGTAGAAATCAAAGCAACTAACTAGACAGAGGTTAATTATGGGGCCACCTCATTGCCTGGAGCAGTGTTGACCTTTTCACCTCTCTGGAAATCTTCCCACCGTTCACCTCATTAATCTCTATACACTGCGCTATTTCCTCACCCAGGCAAAAAGGGCACACGCCTGTCTAAGAGCGACATCCGCGTACAAATCGTGCACAGCGACCACAACGCAGCAAGAGGAAACGACGATGAGGAGGATGTCAAGGAACCCATGGTAAGTCGCTCTCGAAACATTTTGTAAATGCTTAGAATGGTAGGAATAGCTTGTACATTATTTTTCTTTTAT
Associated Phenotype:
Not determined