Busch Lab

ZMP

si:dkey-158b13.2

Ensembl ID:
ENSDARG00000019426
ZFIN ID:
ZDB-GENE-060503-334
Description:
Triple functional domain protein [Source:UniProtKB/Swiss-Prot;Acc:Q1LUA6]
Human Orthologue:
TRIO
Human Description:
triple functional domain (PTPRF interacting) [Source:HGNC Symbol;Acc:12303]
Mouse Orthologue:
Trio
Mouse Description:
triple functional domain (PTPRF interacting) Gene [Source:MGI Symbol;Acc:MGI:1927230]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa36906 Nonsense Mutation detected in F1 DNA Not yet available
sa32258 Nonsense Available for shipment Available now
sa44924 Nonsense Mutation detected in F1 DNA Not yet available
sa36905 Nonsense Mutation detected in F1 DNA Not yet available
sa12039 Nonsense Available for shipment Available now
sa23586 Nonsense Available for shipment Available now
sa44923 Nonsense Mutation detected in F1 DNA Not yet available
sa12333 Nonsense Available for shipment Available now
sa11605 Nonsense Available for shipment Available now
sa36904 Nonsense Mutation detected in F1 DNA Not yet available
sa36903 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36906
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 35 3087 1 57
ENSDART00000144275 None None 3028 None 56
Genomic Location (Zv9):
Chromosome 19 (position 43526815)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42405863
GRCz11 19 41991002
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAACGGCAATGTGGCGTCACTTTTGGACAACCACAGGTGGCAGTACGCA[C/T]AGACGGGCAACACGCTGATTCAGCTGCCAGGTAAAGCCTTGACGCCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32258
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 213 3087 5 57
ENSDART00000144275 Nonsense 154 3028 4 56
Genomic Location (Zv9):
Chromosome 19 (position 43482543)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42361591
GRCz11 19 41946730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTGACGGCTGACTTTGAGGGCAGCCTGGACTACAACCATGAAGAGTG[G/A]ATTGAAATCCGCGTGGCCTTCGAAGACTTTACAGGCAATGCTCGGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44924
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 427 3087 7 57
ENSDART00000144275 Nonsense 368 3028 6 56
Genomic Location (Zv9):
Chromosome 19 (position 43477564)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42356612
GRCz11 19 41941751
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATCATGTCTGTGGGGAACCGGCTGCTGGAGGCCGGTCATTACGCGTCG[C/T]AGCAGATCAAGCAGATCTCAGGTCAGCTGGAGCAGGAGTGGAAAGCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36905
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 649 3087 11 57
ENSDART00000144275 Nonsense 590 3028 10 56
Genomic Location (Zv9):
Chromosome 19 (position 43465092)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42344140
GRCz11 19 41929279
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAATGCGGATAAGCTTCTGGAAGCGGCAGAGCAGCTGGCCCAGACAGGC[G/T]AGTGTGACCCAGAGGAGATCTATCAGGCCGCTCATCAGCTGGAGGACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12039
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 836 3087 14 57
ENSDART00000144275 Nonsense 777 3028 13 56
Genomic Location (Zv9):
Chromosome 19 (position 43450714)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42329762
GRCz11 19 41914901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCGCAGCAGATGAATGAGTTTGATACAGAAGACCTGACGCTGGCTGAA[C/T]AGAGACTGCAGCACCAYGCTGATAAAGCCCTGACCATGAACAACCTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23586
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 1355 3087 25 57
ENSDART00000144275 Nonsense 1296 3028 24 56
Genomic Location (Zv9):
Chromosome 19 (position 43430029)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42309077
GRCz11 19 41894216
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATCCCACCAGGCATCGTCAACAAAGAGCACATCATTTTTGGTAACATG[C/T]AAGATCTGTACGAGTTCCATCACAAGTGAGTTCAATCTTTCAGCCTGAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29256
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Essential Splice Site 1363 3087 25 57
ENSDART00000144275 Essential Splice Site 1304 3028 24 56
Genomic Location (Zv9):
Chromosome 19 (position 43430003)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42309051
GRCz11 19 41894190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCACATCATTTTTGGTAACATGCAAGATCTGTACGAGTTCCATCACAA[G/A]TGAGTTCAATCTTTCAGCCTGAATCAATCCTGCCGTCCAGCATTCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44923
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 2035 3087 40 57
ENSDART00000144275 Nonsense 1976 3028 39 56
Genomic Location (Zv9):
Chromosome 19 (position 43405440)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42284488
GRCz11 19 41869627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGAAAAGACAAGATCGTTTTTGGAAACATTCAGCAGATATATGACTG[G/A]CACAAAGAGTATGTATCTAGTTTGGGATGTATTACTACACATGACACGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7887
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 2160 3087 45 57
ENSDART00000144275 Nonsense 2101 3028 44 56
Genomic Location (Zv9):
Chromosome 19 (position 43399345)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42278393
GRCz11 19 41863532
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGRTCATGTGCATTGTACCAAAAAGATGCAACGACATGATGAATGTTGGT[C/T]GACTCCAGGGGTTTGATGTAAGNNNNTGGTATTTTTCATACCAGTRGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12333
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 2160 3087 45 57
ENSDART00000144275 Nonsense 2101 3028 44 56
Genomic Location (Zv9):
Chromosome 19 (position 43399345)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42278393
GRCz11 19 41863532
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGRTCATGTGCATTGTACCAAAAAGATGCAACGACATGATGAATGTTGGT[C/T]GACTCCAGGGGTTTGATGTAAGNNNNTGGTATTTTTCATACCAGTRGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11605
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 2320 3087 48 57
ENSDART00000144275 Nonsense 2261 3028 47 56
Genomic Location (Zv9):
Chromosome 19 (position 43393641)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42272689
GRCz11 19 41857828
KASP Assay ID:
2261-3645.1 (used for ordering genotyping assays)
KASP Sequence:
AGGGTCCTGGTGTGWCAGGCAGCGGTGTACAGRCTGGAGGCAGCGGGGGG[C/T]AGATGATGGCCCCTGGAGGAGGAGTAGGGGTCYCGGCTGGGCCGGGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36904
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Nonsense 2422 3087 48 57
ENSDART00000144275 Nonsense 2363 3028 47 56
Genomic Location (Zv9):
Chromosome 19 (position 43393335)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42272383
GRCz11 19 41857522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAACAGACGGACTCCCAACAGACAGAAAGCCCAGCCAAAGAGATCCCA[C/T]GAGCCACTGTGGCCCCGCTGGCTCTTGTCAAACCCAGACCTGGAACGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36903
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087055 Essential Splice Site 2615 3087 49 57
ENSDART00000144275 Essential Splice Site 2556 3028 48 56
Genomic Location (Zv9):
Chromosome 19 (position 43389719)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42268767
GRCz11 19 41853906
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGACACACATCCGCCATCATCCCTGACGCTCCAGACGGAACCATAAAG[T/A]AAGAACGGTTACATAACACATGATGTTTGTGTTTTATATAGGCCATATAA
Associated Phenotype:
Not determined