Busch Lab

ZMP

zgc:153573

Ensembl ID:
ENSDARG00000019405
ZFIN IDs:
ZDB-GENE-060929-776, ZDB-GENE-060929-776
Description:
contactin 4 [Source:RefSeq peptide;Acc:NP_001073520]
Human Orthologues:
CNTN3, CNTN4, CNTN6
Human Descriptions:
contactin 3 (plasmacytoma associated) [Source:HGNC Symbol;Acc:2173]
contactin 4 [Source:HGNC Symbol;Acc:2174]
contactin 6 [Source:HGNC Symbol;Acc:2176]
Mouse Orthologues:
Cntn3, Cntn4, Cntn6
Mouse Descriptions:
contactin 3 Gene [Source:MGI Symbol;Acc:MGI:99534]
contactin 4 Gene [Source:MGI Symbol;Acc:MGI:1095737]
contactin 6 Gene [Source:MGI Symbol;Acc:MGI:1858223]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8242
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007545 Essential Splice Site 407 1028 10 23
ENSDART00000127425 Essential Splice Site 407 1028 9 22
Genomic Location (Zv9):
Chromosome 6 (position 45656216)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45717150
GRCz11 6 45719032
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAAYAAGTATGGAGAAGTCTATTCCAATGCTGAACTCAGAGTTATCGG[T/C]GAGTGAAACCTGGTTAATCGCATTTGACTTACATATTGGTGWTGCTTTAT
Long Flanking Sequence:
TACATTCCATCTCGTAGCAGAAACGGTATAAACCTGTCAGCTTTAAAATATTATCCCTGCTTGTTTATAATGGCAAACATCATACAGCCTCCCAGCGGCTTGTCCACAGAATACAGAGGCTCCAGCTCTGGTTAAGAAGTAAACAAGTCGAGGCTTTATTTCCATCTCATAAACATATAGATTTATTACCATCGTTTTTGAGCAGCCTCCCTACGCAGTGTCTCCCATTAGTAATGAACACTCCGATTTATGACCGTTTCCATCAACCTCCAGACATAATTTACCTTCCCAGACACGTTGTGCTTTTATGCAGATTAGCAATCTCAGTAAAAGACTCTTAACGGAGATATCCTGTTTTTTTCCCTACAGGAGAGGGTGCAGGTCATTAATGGCGCCCTGTCCATCACTCACCTGGCACTCTCTGATATTGGGATGTACCAGTGTGTGGCTGGAAACAAGTATGGAGAAGTCTATTCCAATGCTGAACTCAGAGTTATCGG[T/C]GAGTGAAACCTGGTTAATCGCATTTGACTTACATATTGGTGTTGCTTTATGGAATAATGTGTGCATTAATAAAGCTTATTACACAGCTGTCTGGAATACTTGATTCTGATTGGTCACACCATTCGAATGTATGGTATCCGCAGATAACAACCGCTAATACTAATAACATGAGAATAATTTTGACCATCCGTGAATTACATTCACGTCATTGTCCGTCATGATGCTGTTTTTGACTGTTTGGGGCTGAATAATATGTAAGTTAGTGTATGCTTCATTCAGCCGCTTTTGTTTCTGTTAGCTTTGCTTTGAATTAAACATTTATTAAACTAAATAATAAAGTAATTTTTACATTTTGTGGCAAGTAGCCCTTTAAAAAATGGGACAAAGTACATCCAGACGGTTCTTTCTGCTATTTTTCTATCTGCTAATAAACATGTTGAGCTTTATTCTGTGATTAAAAACCACCCGGATGTACTTTATTCCTTACTTACACTCTTTAT
Associated Phenotype:
Not determined