Busch Lab

ZMP

flt1

Ensembl ID:
ENSDARG00000019371
ZFIN ID:
ZDB-GENE-050407-1
Description:
vascular endothelial growth factor receptor 1 [Source:RefSeq peptide;Acc:NP_001014829]
Human Orthologue:
FLT1
Human Description:
fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor recep
Mouse Orthologue:
Flt1
Mouse Description:
FMS-like tyrosine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:95558]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa30092 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1504 Essential Splice Site Available for shipment Available now
sa15078 Essential Splice Site Available for shipment Available now
sa301 Nonsense F2 line generated Not yet available
sa37886 Nonsense Available for shipment Available now
sa37885 Nonsense Available for shipment Available now
sa12242 Essential Splice Site Available for shipment Available now
sa39448 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8038
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Nonsense 61 1272 3 30
ENSDART00000130446 Nonsense 61 473 3 11
Genomic Location (Zv9):
Chromosome 24 (position 22411275)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21658153
GRCz11 24 21803327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTACCCTAAACTTGATGTTTTAGGGGACGGTGGGAGCTCCAGTGGGTTT[T/A]GCCATCAGGCGTACCAAAACTCTACCCCGRCACACATATTGTGAACACTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1059
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Nonsense 301 1272 7 30
ENSDART00000130446 Nonsense 301 473 7 11
Genomic Location (Zv9):
Chromosome 24 (position 22398025)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21644903
GRCz11 24 21790077
KASP Assay ID:
554-0962.1 (used for ordering genotyping assays)
KASP Sequence:
TACAGCGTCCTTACAATCCCCAGCCTGAGCAAAGCAGACAAAGGACTTTA[C/A]AAATGTCAAGTAACCAGTGGTCCATCCAAACGAGAGACAAACACCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30092
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Essential Splice Site 361 1272 8 30
ENSDART00000130446 Essential Splice Site 361 473 8 11
Genomic Location (Zv9):
Chromosome 24 (position 22396803)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21643681
GRCz11 24 21788855
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGCCTCACTCCGAAATTAAAGGCTTTCCCTGCACCTGAAATCATCTGG[T/G]AAAAAAAGCTGTAATCTGAAGGGATCAAGAATGATGTTTTTGTTCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1504
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Essential Splice Site 418 1272 9 30
ENSDART00000130446 Essential Splice Site 418 473 9 11
Genomic Location (Zv9):
Chromosome 24 (position 22396549)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21643427
GRCz11 24 21788601
KASP Assay ID:
554-1429.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCAGTACGGRCTTTTCCAGAACCTCACCATCACACTGGTGGTAAATGG[T/G]GAGAGTCTGCTTTCATTAAACTACTTGATTGTGATTGGTTGAAAAAAAAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15078
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Essential Splice Site 507 1272 11 30
ENSDART00000130446 None None 473 None 11
Genomic Location (Zv9):
Chromosome 24 (position 22386305)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21633183
GRCz11 24 21778357
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATCTTGACWATCAGCCACAGACAGGAAGTGTTAGAAGGGAAGAATAAG[G/A]TGAGTGTTCCAGTGGGTGGACTGATCATAGGGGACATGCCAAAYGATAMA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa301
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Nonsense 683 1272 14 30
ENSDART00000130446 None None 473 None 11
Genomic Location (Zv9):
Chromosome 24 (position 22376964)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21623842
GRCz11 24 21769016
KASP Assay ID:
554-3093.1 (used for ordering genotyping assays)
KASP Sequence:
ATCACTCTCCACTGCCCTGCTCGGGGAGTGCCACAGCCACACATAACATG[G/A]TATAAGAACCAAAGGAAGCTCCAGCAGGTGTCTGGTGAGACTAGGAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37886
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Nonsense 742 1272 16 30
ENSDART00000130446 None None 473 None 11
Genomic Location (Zv9):
Chromosome 24 (position 22374006)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21620884
GRCz11 24 21766058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTTCTTTTGTGACAACACTTATTTATGTGTCCTATAGATTCGTCT[G/T]AATCCCTTTCTCTGGAGATCCCGACCCTAGCATGTACGTGTGTTGTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37885
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Nonsense 805 1272 17 30
ENSDART00000130446 None None 473 None 11
Genomic Location (Zv9):
Chromosome 24 (position 22373732)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21620610
GRCz11 24 21765784
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCACCCAGGGGAGGAGCCTCTGGTCGAGCACTGTGATAGGCTACAATA[T/A]GACCCCGCAAAATGGGAGTTTCCACGGGACCGCCTTAAACTGGGTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12242
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Essential Splice Site 922 1272 20 30
ENSDART00000130446 None None 473 None 11
Genomic Location (Zv9):
Chromosome 24 (position 22371361)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21618239
GRCz11 24 21763413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGTCTGCWTACCTCAAGAGTAAACGAGAAGTGTTCCTGTTGAATAGGG[T/C]TAGWCTGTTATTCTGTCTGTAATATCTATCTATCTMTCTATCTMTCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39448
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025621 Nonsense 1239 1272 30 30
ENSDART00000130446 None None 473 None 11
Genomic Location (Zv9):
Chromosome 24 (position 22359084)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21605962
GRCz11 24 21751136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGACTTCATTTAAGTGTCAGTGTTTTGTGTGTTGCAGGTTTTTCTCC[A/T]GAGGTCAAAGTCAGCCTCGTCTGAGCAGCGCCCCCTGTTGTTCTGATCAA
Associated Phenotype:
Not determined