Busch Lab

ZMP

tgfb3

Ensembl ID:
ENSDARG00000019367
ZFIN ID:
ZDB-GENE-030723-4
Description:
transforming growth factor beta-3 [Source:RefSeq peptide;Acc:NP_919367]
Human Orthologue:
TGFB3
Human Description:
transforming growth factor, beta 3 [Source:HGNC Symbol;Acc:11769]
Mouse Orthologue:
Tgfb3
Mouse Description:
transforming growth factor, beta 3 Gene [Source:MGI Symbol;Acc:MGI:98727]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
hu3526 Nonsense Available for shipment Available now
sa36544 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1467 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3526
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019766 Nonsense 181 410 3 7
ENSDART00000147600 Nonsense 66 295 2 6

The following transcripts of ENSDARG00000019367 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 52599463)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51999649
GRCz11 17 52070328
KASP Assay ID:
554-0143.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACGTGTGTTTTTACGGCAGATTCTCCGTCCTGATGAGCACATCGGCAAG[C/T]AGCGCTACATCGGCAGAAAAAACGTGATGATTGGAGGGACGGATGAGTGG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36544
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019766 Essential Splice Site 214 410 3 7
ENSDART00000147600 Essential Splice Site 99 295 2 6

The following transcripts of ENSDARG00000019367 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 52599362)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51999548
GRCz11 17 52070227
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTCCTTCGACGTCACTGAGACCGTACGAGAGTGGCTGACAAACAGAGG[T/C]CAGTCCCATTTAACACTTTAAACTCATCGGAAAGACTCTGGTGTTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1467
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019766 Nonsense 379 410 7 7
ENSDART00000147600 Nonsense 264 295 6 6

The following transcripts of ENSDARG00000019367 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 52588253)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51988439
GRCz11 17 52059118
KASP Assay ID:
554-1392.1 (used for ordering genotyping assays)
KASP Sequence:
TGTACAACACGCTGAACCCRGAGGCGTCTGCGTCCCCCTGCTGCGTTCCT[C/T]AAGACCTGGAGCCGCTCACCATCCTCTACTACGTGGGCCGGACGCCTAAA
Associated Phenotype:
Not determined