Busch Lab

ZMP

sparc

Ensembl ID:
ENSDARG00000019353
ZFIN ID:
ZDB-GENE-030131-9
Description:
SPARC [Source:RefSeq peptide;Acc:NP_001001942]
Human Orthologue:
SPARC
Human Description:
secreted protein, acidic, cysteine-rich (osteonectin) [Source:HGNC Symbol;Acc:11219]
Mouse Orthologue:
Sparc
Mouse Description:
secreted acidic cysteine rich glycoprotein Gene [Source:MGI Symbol;Acc:MGI:98373]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22481 Essential Splice Site Available for shipment Available now
sa22480 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22481
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039660 Essential Splice Site None 291 1 10
ENSDART00000135627 Essential Splice Site None 237 1 9
ENSDART00000141304 None None 157 None 7
ENSDART00000146022 Essential Splice Site None 109 1 7

The following transcripts of ENSDARG00000019353 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 26966309)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25659511
GRCz11 14 25956756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTTCACCAGCTGACTTCTCCTCTGGCTTCTCTGTAAGACGGACAGAAG[G/A]TAAGAGCTTTCATTTGCCTCACCTTGTCATTCTCCAAAAACTTGACTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22480
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039660 Essential Splice Site 58 291 None 10
ENSDART00000135627 Essential Splice Site 58 237 None 9
ENSDART00000141304 Essential Splice Site 63 157 None 7
ENSDART00000146022 Essential Splice Site 70 109 None 7

The following transcripts of ENSDARG00000019353 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 26954415)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25647617
GRCz11 14 25944862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTAATAATTCTGACTTCAAGTATGCCATTAAAGAATTTTTTTTTCTGCT[A/T]GACCCCTGCCTAAACCATCACTGCAAGAAGGGCAAAGTGTGTGAGGTAGA
Associated Phenotype:
Not determined