Busch Lab

ZMP

chrnd

Ensembl ID:
ENSDARG00000019342
ZFIN ID:
ZDB-GENE-030131-6665
Description:
acetylcholine receptor subunit delta [Source:RefSeq peptide;Acc:NP_996947]
Human Orthologue:
CHRND
Human Description:
cholinergic receptor, nicotinic, delta [Source:HGNC Symbol;Acc:1965]
Mouse Orthologue:
Chrnd
Mouse Description:
cholinergic receptor, nicotinic, delta polypeptide Gene [Source:MGI Symbol;Acc:MGI:87893]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30106 Nonsense Mutation detected in F1 DNA Not yet available
sa7519 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30106
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015391 Nonsense 31 518 2 12
Genomic Location (Zv9):
Chromosome 24 (position 25968587)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25545207
GRCz11 24 25690158
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGCAGAATGTTGTGGCCGAAATGAAGAGGAGCGCCTCATCAATTA[T/A]CTTTTTAAGGAGCGTGGCTACAACAAAGAGCTTCGGCCGGTCCAAAATAA
Long Flanking Sequence:
ATGTTGGGTTTTCTGTCCTGCTGTTTGTCAGCTATTGTTCTGTCACGCTTTTATAGTATAACAGGTGTATAGTGAGTTATAGGACTTTTTCTATAAATCAATTTAAATTTAGTTTAAAATATAATTAAAATCTATTTAAAATTAGAGCTTTTTTACACTTTGGTTTACATGTGACTCATTTATATATTTGAAATGTGTTTGGAAGCAAATATTAATAAAATAAATCAGTTTTACATAATATGTTATGTAAAATACTCAATCTGAAGATTATCACTATAATTTTTTTATGATGTCTGTGAAATACAAATTAGTTTTCCAGGAGTATGACATTAAGGTATTTGTACTGTAGATCAGTGTTGGTCAACAATATCTAACTGTTAAAGACTTATTTGTGTGTCAAAATTAGAGCTATACCTATAGTAGATCTTGAAATAGGTCTGACTTGCAGTGTGTTTTGCAGAATGTTGTGGCCGAAATGAAGAGGAGCGCCTCATCAATTA[T/A]CTTTTTAAGGAGCGTGGCTACAACAAAGAGCTTCGGCCGGTCCAAAATAAAGATGAAACTGTAGATATTTACCTGGCTCTGACACTTTCTAATCTCATTTCCTTGGTGAGTGCTTAATATTGCTAATGTAGTGAGATAAAGTGAGATATTAAAGGGATAATTCACCCCAAAGTTAAAACGTACTCACTATTTAATCAATCTCAAGTGGTTCCAAATCATTATGAGTTTGTTTCTTCTGTTGAATGCTAAAAATATTTTGAAGAAAGCTAAAAAAAAAACAAATGTTTTACTTTTATAGTAGGAAAAAACAAATACTATGGAAGTCAATGGTTACCGGTTTCCACCTTTTTACAAAATATCTTCTTTTGAGTTCAACAGAAGAAAGAAAGTCGGACAGTTTTTGGAACAAGTAAAGAGTGAGTAAATGATGACAGATTTTAAGTTTTAGGTGAACCACCCCTTTAAAAGCAAGACATATTAGTATTTACTATTTTAATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7519
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015391 Missense 240 518 7 12
Genomic Location (Zv9):
Chromosome 24 (position 25970444)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25543350
GRCz11 24 25688301
KASP Assay ID:
554-4193.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGCATCCCGAAAGAAAGCAACAAGCACCAGGATATCACCTTTTACCTG[A/T]TCATTAAGCGTAARCCGCTGTTCTACATYGTCAACATAATCATTCCCTGT
Long Flanking Sequence:
TTCCAACATTTTTCAAAATATCTTCTTTTGTGTTCAACAGAAGAAAGAAACTCATAAAAAGGTGTGAGTAGATGAAGATATTTTATAAATAATTGACTATTTACTTTACTATATCTTACTATTTATTTCAGTTTTGGGTGAACTAACCCTGTTGTATGAATTACATTGTGTATTTGTTGCCTTATTTGAGCCCCATAATGCTTAATCTTTTTTTTTCAGCTCGTTAACTTACAACGCTAAAGAGATTAGCTTAAATCTGAAAATGGAGCAGGAAAATACAACATACTACAAGGTGGAATGGATCATCATTGATCCTGAAGGATTCACAGGTGAGCTCTGACATGAGGGTTTTCTATTTCTTTCATATCATCCTACTATAAGATTTATTTATTTCTGCAGAAAATGGTGAGTGGGAAATTGTCCACAAGCCTGCCAGGAGGAACATTTATAAAAGCATCCCGAAAGAAAGCAACAAGCACCAGGATATCACCTTTTACCTG[A/T]TCATTAAGCGTAAACCGCTGTTCTACATTGTCAACATAATCATTCCCTGTGTGCTCATCTCTTTCTTGGCCTCGCTCGTCTATTACCTGCCTGCTGACAGTAAGTGGTCCTCCATTTATTGCATTTGTAAGTCTTTAGATTACACAGAAACATCATTAAAGATAAAAGCAAAAGTAGCAGTACTTTTTGTGTTAAAATGAATGTGTCACAAAATGATGCTGTAACTTTTTTTGACCTGATTCAGGTGGAGAGAAGATGACGCTGTCAATCTCTGTGCTTCTGGCTCAGTCTGTGTTCCTGCTGCTGATTTCACAGCGTCTGCCTGAGACGTCTATGGCTGTTCCTTTAATTGTCAAGTATGCTGGAATATTAATTATTTAAATTGTTGCAAGTTCTTGAATCTGATTGGCTAACAGCCGTGCAACATTTGGTACGTTTTAGACCCTCTGTGGTTGATTTTATTTTTTATTTACACAATTATGCTGTCAAATTGTTGTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5078
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015391 Nonsense 324 518 9 12
Genomic Location (Zv9):
Chromosome 24 (position 25971454)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25542340
GRCz11 24 25687291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTGACAGGTATCTGATGTTTATCATGGTGTTGGTCACTGTGRTGGTGT[T/A]GAATTGTGTCATTGTGTTGAACCTGCATTTTCGGACGCCCAGCACACACG
Long Flanking Sequence:
CAATATCACATGAGTAGCACTGCAATATTGCTGTATATCAGCACTGCTGTGATATGTGCTGTAGTAAATCATCATATTACTTATATATATTTAATCATATATTTATTTATTTTGCTTTTTTTTAAGTAAACTATACAGAACAACATTAGAACTAAGCCACAAACAAACTAAAGTAAAACAAACACAGTAGATAAAAATAAATAAATCAAATAATAATAATAAATAAATAAAAAGTGAGGAGATACACAGGATAAACAAATGGGGAAAACTATTTTGTCAAATCAAATAATGTGTTACTGTTTTTATATAATTTAATCATATATATTTTCATAGGAATGTTGCTTTTACAGTCTGGAATCATAAAAATGACTAGACTAAAGTACTCATTGAAAAAAACAGCTTTAAAGTACAAGTTGTTGTTTTTAAAATAGTAATAATAAATGTTTTTGTATTTGACAGGTATCTGATGTTTATCATGGTGTTGGTCACTGTGGTGGTGT[T/A]GAATTGTGTCATTGTGTTGAACCTGCATTTTCGGACGCCCAGCACACACGTCATGACGGAATGGACCAAAGAGGTTAGACTCTCACTTGTTTGTAGAATAAAAATTAATAAATTGCGCAAGTCATCACAGTGGAAAACATTGCATTTTAATGATGGTGTCAAACGGTAAAAATATAAGAAACAAAACACAAAAAAAGTGAAATTATGCATGAAAATAAGCTGATTCGAATTTTATAACTTGATTGAATAGGTGTTATCAGTAATTATCAGCTCATAGATATGGGCCAGTAGGGGCCTTCTGCACCTACTGGTAGGCTCAGAAGGCTATCATCAATCAACATACTATACATCACATATGGCTGATGGGTACTGCTGCCAAATTTTATATATATACAATATATATATTAATAAATTTCCCATTAATTGTATTTTATTAATGTCTATCAATACCCAACGCTAAACCCAACCATCACAGTAATGTAAAACAGATCTGGTTCTAT
Associated Phenotype:
Not determined