Busch Lab

ZMP

uxt

Ensembl ID:
ENSDARG00000019339
ZFIN ID:
ZDB-GENE-040912-118
Description:
protein UXT [Source:RefSeq peptide;Acc:NP_001004671]
Human Orthologue:
UXT
Human Description:
ubiquitously-expressed transcript [Source:HGNC Symbol;Acc:12641]
Mouse Orthologue:
Uxt
Mouse Description:
ubiquitously expressed transcript Gene [Source:MGI Symbol;Acc:MGI:1277988]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa8704 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa21201 Nonsense Available for shipment Available now
sa21202 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27132
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021209 Nonsense 15 155 1 6
ENSDART00000137780 Nonsense 15 38 1 6
Genomic Location (Zv9):
Chromosome 8 (position 9244180)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8660762
GRCz11 8 8699347
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATATCATGACTTCTGGCACATCTGTTATTAATGACAAAGTCTTGCAGTA[T/G]GAGACATTCATCAGTGAAGTATTAAGACGAGACCTGCAGTAAGTATCATT
Long Flanking Sequence:
CAATCAGGTATTTTAATTAACACGTTTTGAATGAGAAAGAATTTGTTGGAAGTTGCGTCAACGCTTTAAATTATATTGTATTTACAAATATATTTGTCTTATTGAGAGAATTGTTCTAATAGGTAAACATTAATTAAATAAAAACGAAACGTAGATGTTCATTATAGGAAAACTATAAAACAAAAGTTTAGCTAACGCCATTTCCGGTTTAGACCGAGGACGTTTCCGCGTATCTTGTAAACAAGTGTGGAGCCACGTGACAGACCGAAGGAAGGTTTAGCTTCATTTAACGTACTCGATACTTCATATATTTGCTACTACAATATATTAATCTGTCATATGTAAGCTTTAATCGCTGCATCAGCCCAGCGACGTGCTGTTAATGTTTGATGCACATTAATATTAGAAACATCGATTGCTATTAAATAAAACTTCGATCTGTTATCATCTCATATCATGACTTCTGGCACATCTGTTATTAATGACAAAGTCTTGCAGTA[T/G]GAGACATTCATCAGTGAAGTATTAAGACGAGACCTGCAGTAAGTATCATTTAATATGGATATTTTGCACGTACACGAAGCTGCCATGGTATTAACGTTACCATGCTTGTACGTTAATTCCATACAAATACAGCTCTATGCTAATCTATATTGTTTAAGCTAATCTATTATGAAATGCTACTATGTGTTCTGGAAACATTATGTACGCTTGTCCAAAGTACTTGTTTAAATGAGCTGAATCAACACGATTCTTGAGTTTTTTTTAGCACAACTACATTTTTTTATTTCAGTTTACTTAAATTTGTAAAAACAATAAAGTTAACTTGATCGATTTGTGTTGGGACAAGATGAAGGAATTAATAACCCTGTGGAACCCAGTATAAGGAACACTATAGTACTTTATTGTAATTTTAATGGTGTTTTTAAACAATACTATAGTAAAGTGAATTGTACTATACACACACCAGCCACTTTATTAGGTACACCTTTCAAGTCCCGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8704
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021209 Splice Site, Nonsense 56 155 3 6
ENSDART00000137780 Splice Site None 38 3 6
Genomic Location (Zv9):
Chromosome 8 (position 9246483)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8663065
GRCz11 8 8701650
KASP Assay ID:
2260-0158.1 (used for ordering genotyping assays)
KASP Sequence:
ATTCTGCCTTGTGCGCTTTWAATATGTGGCTGTGTTTGATTCACCTTCAG[G/T]AAAGCGGCAGCAAAGAACTGAAAACCGATGTTGACCTTGGCTGCAATTTC
Long Flanking Sequence:
ATAATATGATTCAAAATACTATAGTATTTACAATAAATACATTAGTATTTTTTCATGTAAGTTCTTTTTGCTCCACCAGGAAAGTGGTGGAGCAAAAGAGATGCTGTGGATGAGAAAATACGGCAATACCTGCAGCTGAAGAACACAATATAATAAAATATAGTTCAAGAACACTATAGTATTTACCATAAATTACTATAGTATTTTTTCATTTGAGTACTCTCTGCTCTGCCAGGAAAGTGCTGGAGCAAAGAGATGCTGTGTATGAGAAAATCGCACAATACCTGCAGCTGAAGAACACAATACAAAGCATTCAGGTATGTGAGATTTGCATATGTATTTGCATATTTTGTGCTTATTCTTATGTCCTGACTTATTTGTTTTCAGATATAGTTTGTGCTGTGTAAAAAATTTTTACATTTACTATTACTGTCCATCTCAGTTGCTCTCATTCTGCCTTGTGCGCTTTTAATATGTGGCTGTGTTTGATTCACCTTCAG[G/T]AAAGCGGCAGCAAAGAACTGAAAACCGATGTTGACCTTGGCTGCAATTTCTATGTGCAGGCTCATGTGTAAGTGTTGTTTGCATGACGTCTGTGGTGCTGTGCGTCAGTGGAGATGTTGAACATTTTTTGAAAGGGCAATCTCATTTCTTTTTTTCCAGACCTGATGCATCAAGAATATATGTGGCAGTCGGATATGGATTCTTTGTCGAATTCACGCACGCAGAGGCTTTGAAGTTCATTGAAAAGAAGACAAATCAGCTCACAGAGTAAGAGGATTTTAGTAGTGCTGTCAAACGATCGAGATTATTTGCATCAAAATTAAAAGTTTATATTTGCTAAATAGATTTTTGTGTCTAAATATACGCATGACTATGACTTTAAATTTATTTATTCATTCGTTTTCATTCGACTTAGTCCCTTTATTCATCAGAGGTCGCCACAGTGGAATGAACCGCCAACTTATCCAGCAAATGTTTTAGACAGTGGATACCCTTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21201
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021209 Nonsense 82 155 4 6
ENSDART00000137780 None None 38 4 6
Genomic Location (Zv9):
Chromosome 8 (position 9246654)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8663236
GRCz11 8 8701821
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTTTTTGAAAGGGCAATCTCATTTCTTTTTTTCCAGACCTGATGCAT[C/A]AAGAATATATGTGGCAGTCGGATATGGATTCTTTGTCGAATTCACGCACG
Long Flanking Sequence:
CACTATAGTATTTACCATAAATTACTATAGTATTTTTTCATTTGAGTACTCTCTGCTCTGCCAGGAAAGTGCTGGAGCAAAGAGATGCTGTGTATGAGAAAATCGCACAATACCTGCAGCTGAAGAACACAATACAAAGCATTCAGGTATGTGAGATTTGCATATGTATTTGCATATTTTGTGCTTATTCTTATGTCCTGACTTATTTGTTTTCAGATATAGTTTGTGCTGTGTAAAAAATTTTTACATTTACTATTACTGTCCATCTCAGTTGCTCTCATTCTGCCTTGTGCGCTTTTAATATGTGGCTGTGTTTGATTCACCTTCAGGAAAGCGGCAGCAAAGAACTGAAAACCGATGTTGACCTTGGCTGCAATTTCTATGTGCAGGCTCATGTGTAAGTGTTGTTTGCATGACGTCTGTGGTGCTGTGCGTCAGTGGAGATGTTGAACATTTTTTGAAAGGGCAATCTCATTTCTTTTTTTCCAGACCTGATGCAT[C/A]AAGAATATATGTGGCAGTCGGATATGGATTCTTTGTCGAATTCACGCACGCAGAGGCTTTGAAGTTCATTGAAAAGAAGACAAATCAGCTCACAGAGTAAGAGGATTTTAGTAGTGCTGTCAAACGATCGAGATTATTTGCATCAAAATTAAAAGTTTATATTTGCTAAATAGATTTTTGTGTCTAAATATACGCATGACTATGACTTTAAATTTATTTATTCATTCGTTTTCATTCGACTTAGTCCCTTTATTCATCAGAGGTCGCCACAGTGGAATGAACCGCCAACTTATCCAGCAAATGTTTTAGACAGTGGATACCCTTCCAGCTGCAACCCAGTACTGGGAAACATCCATACACTCTAATTCACACACATACACTACGGCCAATTTAGTGTACTTTGTATATTTATGTAAATGCAAACCATTATCTTGGGTGTGATTTATCATTTGACAGCACTGGTTTTTAGTTATAGTGAAGGCCTGACAAAAGCTGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21202
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021209 Nonsense 115 155 5 6
ENSDART00000137780 None None 38 5 6
Genomic Location (Zv9):
Chromosome 8 (position 9248849)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8665431
GRCz11 8 8704016
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTTTGTGTTACAGTGCAAATATTTACCATTATTTGAATGTTTAGGTA[T/A]ACTGAAGTTCTTACCAAAGATGCAGCAAAGATAAAAGCCAACATTCGCAT
Long Flanking Sequence:
TGTGCTAAAAGATTACCGCTAATTACTGTATGTTTTAAGAAAACTTGCAGTTAATCAGGGCGATGCAGTGGCACAGTAGGTAGTGCGGTCGCCTCACAACAAGAAGGTCGCTGGTTCGAGCCTCAGCTGGGTCAGTTGGCGTTTCAGTGTGGAGTTTGCATGTTTTCCCTACATGTGCATGGGTTTCTTCCGGGTGCTCCGGTTTCCCCCACAGTCCAAAGACATGCGGTAGAGTTGAATTAGGCTAAGTTGTCCGTAGTGTATGAGTGTGTATGGATGTTTCCCAGAGATGGGTTGCAGCTGGAAGGGCATCCGCTGCGTAAAACATTTCATGGATAAGTTGGCGGTTCTTTCCACTGTGGTGACCCCAGATTAATAAAGGGACTAAGCTGAAAAGAGAATGAATGAATGAATACTGTCAGCTTATGCATTTTTACCTTTGAAATCAGCCTTTTTTGTGTTACAGTGCAAATATTTACCATTATTTGAATGTTTAGGTA[T/A]ACTGAAGTTCTTACCAAAGATGCAGCAAAGATAAAAGCCAACATTCGCATGGTTCTGGAGGTATACGTGATTATTAATATACATTTTTTTAACTTGCTTTTTACTTTTGCTTTTTTGTTTTTACCATTTATTGTGATTTAGAATGTAATAAAATGTGATAAAACTCTGTTTTCACAGGGGTTGAGGGAATTGCAAGGACTGAAGGATCTTCCAGAGGACAGAAGGAGAGAGGTGTTTTAGTACCATACACCAATCACAGCACAGTGTATTCATCTTTGCACATATGACTGCAATGTTTGTTTCAAACAATGTGAACATTATGGCAATCATGTTCAGAAGAACGTTGCCTTTTAACAGGTTGTACTGTTGTTTCCAGAAATAGCTGCTGAATAAAGTGTAAAATTTTTCAGTTAATATGTGTCAGTGGGATTGTTATTAATGTTTAGATCACTTTTTGTGCTTCTTTTTCCTTCAGCTTAGTCACTTATTTATCAGGGGTC
Associated Phenotype:
Not determined