Busch Lab

ZMP

zgc:63466

Ensembl ID:
ENSDARG00000019311
ZFIN ID:
ZDB-GENE-040426-1125
Description:
hypothetical protein LOC393404 [Source:RefSeq peptide;Acc:NP_956726]
Human Orthologue:
FBXO30
Human Description:
F-box protein 30 [Source:HGNC Symbol;Acc:15600]
Mouse Orthologue:
Fbxo30
Mouse Description:
F-box protein 30 Gene [Source:MGI Symbol;Acc:MGI:1919115]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37587 Nonsense Mutation detected in F1 DNA Not yet available
sa37586 Nonsense Mutation detected in F1 DNA Not yet available
sa9676 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4227
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013635 Nonsense 338 831 2 3
ENSDART00000126564 Nonsense 338 831 1 2
Genomic Location (Zv9):
Chromosome 23 (position 1588720)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1557095
GRCz11 23 1566202
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGGTTGAATCTGGGGCTGTTGGGGGATTGGATGGTGGAGAGACCGCTT[T/A]AGATGTTCTTGCTCATGCGGCAKCAGATGAGTGTTGCCCAGACATGTTAG
Long Flanking Sequence:
TGAGATGGAGCACGCAGCAGGCTGCTCTAAAGACAAGATATCTAATGGGATTAATGGTCTAAAGGAAGAGCATTACGGAGAGCTTTACCAAACCACGGTAGAGACAACCAAAAGCCTGACTGCAGCTCTGAACGTCCTGATCCACCTCAATTCTACAGATACAGACTGCACAGCTAATAATGTGTCAGCTGCACTTCCAGAGCGCAATGGGGAACTACATGAGAGGGTGAGAACTACAGAAGACTCAAAAATAGCCAGCGGAGTCAATGGTCTAAAGGAGGAGCTACAGCCTCAACAGCACCACAAACTCATGGAGCTCGGCAGGAGCTTGGCATCTGCCCTCGGTGCACTGGGAGATGCGGTTAAAGGCACTGAGCCTGTTAGCGGCTCGATAGTTATTGAGAACGGTGAGCTCATCCCGTCAGAAACCTTGGAGGCTGTGGATGTTGAAATGGTTGAATCTGGGGCTGTTGGGGGATTGGATGGTGGAGAGACCGCTT[T/A]AGATGTTCTTGCTCATGCGGCAGCAGATGAGTGTTGCCCAGACATGTTAGTGGACCTAGATAGGCAAGGTTTCTGCAATGGCTCTCATAGTATGGTAGATCACCTAATGGATTCTACTACAAATCACAATCAAATCCCAGAGTCCCGAGGCTCTTGGGAGATTGTTGGCCCTTTAGTTCCCCATAGACCTGAGATCAGACATGACCAACATGCTTTCTTGATCCAGGAGGCCTCTGGATCACAAGCCCCATTGCTTCAGCAGCCTGTACACGCTCAGACTCTGACGGTCCAGAGAGACGTTGAGCTGCCTTCAATGGCATTAGACTTTGAGGATCGGGCTTTTGAGAGGAAACTCCAAAACCTGCAGTTTCTGCGCAGTTTTATGCCACTTGCTCTTAATGGACGAAAGAGCTCTTTTACCGAATCGTTCCCCTATAGAAATCCACGCTGCAAAATGGAGGACAAAGCTGTGGATACGTCAGATTTAGATCAGGAGCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37587
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013635 Nonsense 363 831 2 3
ENSDART00000126564 Nonsense 363 831 1 2
Genomic Location (Zv9):
Chromosome 23 (position 1588644)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1557019
GRCz11 23 1566126
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGAGTGTTGCCCAGACATGTTAGTGGACCTAGATAGGCAAGGTTTCTG[C/A]AATGGCTCTCATAGTATGGTAGATCACCTAATGGATTCTACTACAAATCA
Long Flanking Sequence:
GGAGAGCTTTACCAAACCACGGTAGAGACAACCAAAAGCCTGACTGCAGCTCTGAACGTCCTGATCCACCTCAATTCTACAGATACAGACTGCACAGCTAATAATGTGTCAGCTGCACTTCCAGAGCGCAATGGGGAACTACATGAGAGGGTGAGAACTACAGAAGACTCAAAAATAGCCAGCGGAGTCAATGGTCTAAAGGAGGAGCTACAGCCTCAACAGCACCACAAACTCATGGAGCTCGGCAGGAGCTTGGCATCTGCCCTCGGTGCACTGGGAGATGCGGTTAAAGGCACTGAGCCTGTTAGCGGCTCGATAGTTATTGAGAACGGTGAGCTCATCCCGTCAGAAACCTTGGAGGCTGTGGATGTTGAAATGGTTGAATCTGGGGCTGTTGGGGGATTGGATGGTGGAGAGACCGCTTTAGATGTTCTTGCTCATGCGGCAGCAGATGAGTGTTGCCCAGACATGTTAGTGGACCTAGATAGGCAAGGTTTCTG[C/A]AATGGCTCTCATAGTATGGTAGATCACCTAATGGATTCTACTACAAATCACAATCAAATCCCAGAGTCCCGAGGCTCTTGGGAGATTGTTGGCCCTTTAGTTCCCCATAGACCTGAGATCAGACATGACCAACATGCTTTCTTGATCCAGGAGGCCTCTGGATCACAAGCCCCATTGCTTCAGCAGCCTGTACACGCTCAGACTCTGACGGTCCAGAGAGACGTTGAGCTGCCTTCAATGGCATTAGACTTTGAGGATCGGGCTTTTGAGAGGAAACTCCAAAACCTGCAGTTTCTGCGCAGTTTTATGCCACTTGCTCTTAATGGACGAAAGAGCTCTTTTACCGAATCGTTCCCCTATAGAAATCCACGCTGCAAAATGGAGGACAAAGCTGTGGATACGTCAGATTTAGATCAGGAGCCGGTGGATGACCCTATGGGACTTGGAGAAATTGACTTCACGGCAGCCGCACTTCTATTCTGCCTTGAGGAGTCGCCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37586
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013635 Nonsense 413 831 2 3
ENSDART00000126564 Nonsense 413 831 1 2
Genomic Location (Zv9):
Chromosome 23 (position 1588496)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1556871
GRCz11 23 1565978
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTTCCCCATAGACCTGAGATCAGACATGACCAACATGCTTTCTTGATC[C/T]AGGAGGCCTCTGGATCACAAGCCCCATTGCTTCAGCAGCCTGTACACGCT
Long Flanking Sequence:
GGGTGAGAACTACAGAAGACTCAAAAATAGCCAGCGGAGTCAATGGTCTAAAGGAGGAGCTACAGCCTCAACAGCACCACAAACTCATGGAGCTCGGCAGGAGCTTGGCATCTGCCCTCGGTGCACTGGGAGATGCGGTTAAAGGCACTGAGCCTGTTAGCGGCTCGATAGTTATTGAGAACGGTGAGCTCATCCCGTCAGAAACCTTGGAGGCTGTGGATGTTGAAATGGTTGAATCTGGGGCTGTTGGGGGATTGGATGGTGGAGAGACCGCTTTAGATGTTCTTGCTCATGCGGCAGCAGATGAGTGTTGCCCAGACATGTTAGTGGACCTAGATAGGCAAGGTTTCTGCAATGGCTCTCATAGTATGGTAGATCACCTAATGGATTCTACTACAAATCACAATCAAATCCCAGAGTCCCGAGGCTCTTGGGAGATTGTTGGCCCTTTAGTTCCCCATAGACCTGAGATCAGACATGACCAACATGCTTTCTTGATC[C/T]AGGAGGCCTCTGGATCACAAGCCCCATTGCTTCAGCAGCCTGTACACGCTCAGACTCTGACGGTCCAGAGAGACGTTGAGCTGCCTTCAATGGCATTAGACTTTGAGGATCGGGCTTTTGAGAGGAAACTCCAAAACCTGCAGTTTCTGCGCAGTTTTATGCCACTTGCTCTTAATGGACGAAAGAGCTCTTTTACCGAATCGTTCCCCTATAGAAATCCACGCTGCAAAATGGAGGACAAAGCTGTGGATACGTCAGATTTAGATCAGGAGCCGGTGGATGACCCTATGGGACTTGGAGAAATTGACTTCACGGCAGCCGCACTTCTATTCTGCCTTGAGGAGTCGCCGAGAGCTCGGAGGATATCCGACACGGTTTACGCATTCGGGGGAACGCGTGTTGATTTCGGCACCCAGACGTTTAGTTTTCCTGCTGCCATCTTGGCAACGAGTACGATGGTTGGAGAGGTCGCGTCCGCATCCGCTTGCGATCGAGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9676
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013635 Nonsense 500 831 2 3
ENSDART00000126564 Nonsense 500 831 1 2
Genomic Location (Zv9):
Chromosome 23 (position 1588234)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1556609
GRCz11 23 1565716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGAAATCCACRCTGCAAAATGGAGGACAAAGCTGTGGATACGTCAGATT[T/G]AGATCAGGAGCCGGTGGATGAYCCTATGGGACTTGGAGAAATTGACTTCA
Long Flanking Sequence:
TGGAGAGACCGCTTTAGATGTTCTTGCTCATGCGGCAGCAGATGAGTGTTGCCCAGACATGTTAGTGGACCTAGATAGGCAAGGTTTCTGCAATGGCTCTCATAGTATGGTAGATCACCTAATGGATTCTACTACAAATCACAATCAAATCCCAGAGTCCCGAGGCTCTTGGGAGATTGTTGGCCCTTTAGTTCCCCATAGACCTGAGATCAGACATGACCAACATGCTTTCTTGATCCAGGAGGCCTCTGGATCACAAGCCCCATTGCTTCAGCAGCCTGTACACGCTCAGACTCTGACGGTCCAGAGAGACGTTGAGCTGCCTTCAATGGCATTAGACTTTGAGGATCGGGCTTTTGAGAGGAAACTCCAAAACCTGCAGTTTCTGCGCAGTTTTATGCCACTTGCTCTTAATGGACGAAAGAGCTCTTTTACCGAATCGTTCCCCTATAGAAATCCACGCTGCAAAATGGAGGACAAAGCTGTGGATACGTCAGATT[T/G]AGATCAGGAGCCGGTGGATGACCCTATGGGACTTGGAGAAATTGACTTCACGGCAGCCGCACTTCTATTCTGCCTTGAGGAGTCGCCGAGAGCTCGGAGGATATCCGACACGGTTTACGCATTCGGGGGAACGCGTGTTGATTTCGGCACCCAGACGTTTAGTTTTCCTGCTGCCATCTTGGCAACGAGTACGATGGTTGGAGAGGTCGCGTCCGCATCCGCTTGCGATCGAGCTGCACCACGCCTTTCGCAACCAAGTCCGTTTTGCACACTTCGCCTTGATCTGACTCTGGAGCAGCTCGTGCCTCGTCCAAGCTGGGCTCCACGTGAGGGCTCGATGTTTACCTTCGAATGCGGACAACTCTTCCGCCGAGAAGAGTTCCTCTCGCATTTCCATAACGTTCACGGAGATATCCACTCTGGACTCAACGGCTGGATGGAGCACCGCTGCCCGTTAGCGTATTACGGCTGCACGTTCTCCCAGCGCAGATTCTGCCCAT
Associated Phenotype:
Not determined