Busch Lab

ZMP

sec14l1

Ensembl ID:
ENSDARG00000019301
ZFIN ID:
ZDB-GENE-040426-801
Human Orthologue:
SEC14L1
Human Description:
SEC14-like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:10698]
Mouse Orthologue:
Sec14l1
Mouse Description:
SEC14-like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1921386]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33339 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33339
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009973 Nonsense 68 675 2 20
ENSDART00000132110 None None 223 None 4
Genomic Location (Zv9):
Chromosome 3 (position 60970904)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60060780
GRCz11 3 59413243
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCAGGAGTGGACTACATGTACTTCATCCAGAAGAACTCTCTGAACCGT[A/T]GAGAGAGAACCTTACACATCGAGGCCTATAATGAATCCTTCTCCAGCAGA
Associated Phenotype:
Not determined