Busch Lab

ZMP

ints7

Ensembl ID:
ENSDARG00000019300
ZFIN ID:
ZDB-GENE-021220-6
Description:
Integrator complex subunit 7 [Source:UniProtKB/Swiss-Prot;Acc:Q8JGR7]
Human Orthologue:
INTS7
Human Description:
integrator complex subunit 7 [Source:HGNC Symbol;Acc:24484]
Mouse Orthologue:
Ints7
Mouse Description:
integrator complex subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1924315]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa4883 Nonsense F2 line generated Not yet available
sa6619 Nonsense Mutation detected in F1 DNA Not yet available
sa32279 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29319
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020703 Nonsense 376 964 9 20

The following transcripts of ENSDARG00000019300 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 13022780)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13212026
GRCz11 20 13108006
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCAGCACATGGAATCACAGTGTTGACTAGCATTGCTGCTTTCTGCCCT[G/T]AGAAAGGTTGGTTCATAGTTCAATTGTAAATAAATTGTTAAAAATTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4883
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020703 Nonsense 598 964 13 20

The following transcripts of ENSDARG00000019300 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 12990809)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13180055
GRCz11 20 13076035
KASP Assay ID:
554-3571.1 (used for ordering genotyping assays)
KASP Sequence:
GAGACTACAGTGCAGCCATGAGCGCCATCTCTGAAGCACTGAAATCCTAC[C/T]AGAAGGGAATCGCATCTCTCACGGTCAGGATTCACTTTTATTTATTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6619
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020703 Nonsense 666 964 14 20

The following transcripts of ENSDARG00000019300 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 12983163)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13172409
GRCz11 20 13068389
KASP Assay ID:
554-4958.1 (used for ordering genotyping assays)
KASP Sequence:
TCGCAACCACGATYGCTCTGTCCTCGGGCAGTGACTTGCAGCGCTGCGGA[C/T]GAATCTCCACACAGGTGCCCAAACACACGCTCCTATTTCTGCTCTYTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32279
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020703 Nonsense 689 964 15 20

The following transcripts of ENSDARG00000019300 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 12982431)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13171677
GRCz11 20 13067657
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCCATGGATGAGTTTAGAAGTCTCGCAGCTCGCTATGCTGACCTGTA[C/A]CAGTCTTCGTTTGATGCGGACTATGCCACCCTTCGCAATGTTGAACTGTA
Associated Phenotype:
Not determined