Busch Lab

ZMP

si:dkey-204a24.9

Ensembl ID:
ENSDARG00000019299
ZFIN ID:
ZDB-GENE-041111-214
Description:
Novel protein similar to vertebrate zinc finger protein 592 (ZNF592) [Source:UniProtKB/TrEMBL;Acc:Q1
Human Orthologue:
ZNF687
Human Description:
zinc finger protein 687 [Source:HGNC Symbol;Acc:29277]
Mouse Orthologue:
Zfp687
Mouse Description:
zinc finger protein 687 Gene [Source:MGI Symbol;Acc:MGI:1925516]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23443 Essential Splice Site Available for shipment Available now
sa45658 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23443
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007137 None None 736 None 2
ENSDART00000104703 Essential Splice Site 758 1431 2 9
ENSDART00000123058 Essential Splice Site 758 1393 2 10
ENSDART00000132336 Essential Splice Site 758 1431 3 10
Genomic Location (Zv9):
Chromosome 19 (position 8450912)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7909451
GRCz11 19 7828376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACGCTTAATGTCATACACTCAATGCTGAATGCCAAATGTTCTGTTTGT[A/T]GGTATGCTTTCTCCGTCACTTTCCTCTCCACCTTTGACATCCTCCACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45658
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007137 None None 736 None 2
ENSDART00000104703 None 1079 1431 6 9
ENSDART00000123058 Essential Splice Site 1079 1393 None 10
ENSDART00000132336 None 1079 1431 7 10
Genomic Location (Zv9):
Chromosome 19 (position 8447714)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7906253
GRCz11 19 7825178
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCCAAACCAGCAACAGAAAACAATTCAGATGAGCTGAGCCAGGGCCC[A/G]GGAGAGGAGGAAGAGGAAGGGGAAGACGAGGAGGGAGAGCAGGAAGGAGA
Associated Phenotype:
Not determined