Busch Lab

ZMP

tfdp1a

Ensembl ID:
ENSDARG00000019293
ZFIN ID:
ZDB-GENE-040426-2883
Description:
RNA-binding protein MEX3A [Source:RefSeq peptide;Acc:NP_998657]
Human Orthologues:
TFDP1, TFDP3
Human Descriptions:
transcription factor Dp family, member 3 [Source:HGNC Symbol;Acc:24603]
transcription factor Dp-1 [Source:HGNC Symbol;Acc:11749]
Mouse Orthologue:
Tfdp1
Mouse Description:
transcription factor Dp 1 Gene [Source:MGI Symbol;Acc:MGI:101934]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38753 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41474 Nonsense Mutation detected in F1 DNA Not yet available
sa18598 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38753
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011561 Essential Splice Site 158 409 6 11
ENSDART00000077800 Essential Splice Site 158 409 7 12
ENSDART00000121828 Essential Splice Site 158 188 7 7
ENSDART00000142347 Essential Splice Site 158 229 7 8

The following transcripts of ENSDARG00000019293 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35933935)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35153446
GRCz11 9 34962631
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATATATAACATGATAAATAAACCAACGCTTTTGGTTTCTGCTTTTTTCA[G/A]CATGTGTATGACCAGAAGAACATTCGACGGCGTGTGTACGATGCTCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41474
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011561 Nonsense 166 409 6 11
ENSDART00000077800 Nonsense 166 409 7 12
ENSDART00000121828 Nonsense 166 188 7 7
ENSDART00000142347 Nonsense 166 229 7 8

The following transcripts of ENSDARG00000019293 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35933960)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35153471
GRCz11 9 34962656
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCTTTTGGTTTCTGCTTTTTTCAGCATGTGTATGACCAGAAGAACATT[C/T]GACGGCGTGTGTACGATGCTCTCAATGTGCTGATGGCCATGAACATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18598
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011561 Essential Splice Site 363 409 10 11
ENSDART00000077800 Essential Splice Site 363 409 11 12
ENSDART00000121828 None None 188 None 7
ENSDART00000142347 None None 229 None 8

The following transcripts of ENSDARG00000019293 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35936434)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35155945
GRCz11 9 34965130
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACGGGGGCTTCAWCYGCAAATGGAGGTGGYCGCTATCAWGTAGGAGGG[T/G]GAGTTTCTTTTGCACATTTTTCTGTTNNNNNNNNNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined