Busch Lab

ZMP

spna2

Ensembl ID:
ENSDARG00000019231
ZFIN ID:
ZDB-GENE-051113-60
Description:
spectrin alpha chain, brain [Source:RefSeq peptide;Acc:NP_001091958]
Human Orthologue:
SPTAN1
Human Description:
spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) [Source:HGNC Symbol;Acc:11273]
Mouse Orthologue:
Spna2
Mouse Description:
spectrin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:98386]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa5681 Nonsense Available for shipment Available now
sa1515 Nonsense Available for shipment Available now
sa23878 Essential Splice Site Available for shipment Available now
sa23879 Nonsense Available for shipment Available now
sa23880 Nonsense Available for shipment Available now
sa23881 Nonsense Available for shipment Available now
sa45731 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5681
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 20 2480 2 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 None None 543 2 57
ENSDART00000124913 Nonsense 20 443 2 10
ENSDART00000140267 None None 179 None 6
ENSDART00000102251 Nonsense 20 2480 2 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 None None 543 2 57
ENSDART00000124913 Nonsense 20 443 2 10
ENSDART00000140267 None None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11366888)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13068253
GRCz11 21 13165241
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGTGGAGTCAAGGTTTTAGAGACGGCAGATGACATCCAAGAGCGCCGA[C/T]AGCAGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGC
Long Flanking Sequence:
CCTGACTCGAGGTCCTTTGCCGACCCTTCTCTCAGCTCCACATACTTTCCTGTCTGTAATCTTCACTGTCCTGTCTATTAAAGGTGAAATCCACGGAAAAAAAATAAATTGTCACACATATTGAACAAAAATGCTCAAAGTTTAGACTTTGAGTGAGTTTTTGTACCATGCAGATTTTGTAGTGCCAATTTTCATTTATATCAATTCAAAATACTTATAATGGCAGTTTTTTTATTTTTTAACTTGTCATTATATTATATTATGTTACTCAAATGTTTTTGAGAAAATTCTCGTGTGCATTTTTCTTATTAGGAAGCCACACTGAGGTTCTTCAAAAATGTTTTCATGTTGTCTGCTTACTAATTCAAAATGAAGTTAGAAAAACCTTTACATTTGAAAGGTTCATCTATTAAACTTTTTTTTTTTTGCCCCACTTTCAGAAAATGGATATCAGTGGAGTCAAGGTTTTAGAGACGGCAGATGACATCCAAGAGCGCCGA[C/T]AGCAGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGCAGACAGAAACTCGAAGACTCTTACCGGTTCCAGTTCTTCCGTCGGGATGCAGATGAACTTGAGAAATGGATCCAAGAGAAGCTACAGATTGCCTCTGATGAGAACTACAAGGACCCCAGTAACCTGCAGGTGAGAGAAGAAGCAAAGTCTACTTTTCTAAGTCCCCATTGTACTTCGATTCATAAACAACTTGGTAGAATATGTTTAGAGAAATTAAGTCCTAAAATGTGCTGTCAGCTGACTCGCCTCTGATCATAAAGTAACTCTTGTTTTTAAGTTGTAAATTCCTTGATTGGGCTTGTCTGTAATCAGCAGTGAATGACTGTATAGAGTTATTACGTTATAAAAGCTTGAATACTGCAAATGGATAGAAGGGTGTATTTTGTATGATGATAAAATAATTAGAACTAAAATTAGACTTGGCAATGTTCCTTTAAAGAAATTCACTCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1514
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 20 2480 2 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 None None 543 2 57
ENSDART00000124913 Nonsense 20 443 2 10
ENSDART00000140267 None None 179 None 6
ENSDART00000102251 Nonsense 20 2480 2 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 None None 543 2 57
ENSDART00000124913 Nonsense 20 443 2 10
ENSDART00000140267 None None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11366888)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13068253
GRCz11 21 13165241
KASP Assay ID:
554-1438.1 (used for ordering genotyping assays)
KASP Sequence:
TCAGTGGAGTCAAGGTTTTAGAGACGGCAGATGACATCCAAGAGCGCCGA[C/T]AGCAGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGC
Long Flanking Sequence:
CCTGACTCGAGGTCCTTTGCCGACCCTTCTCTCAGCTCCACATACTTTCCTGTCTGTAATCTTCACTGTCCTGTCTATTAAAGGTGAAATCCACGGAAAAAAAATAAATTGTCACACATATTGAACAAAAATGCTCAAAGTTTAGACTTTGAGTGAGTTTTTGTACCATGCAGATTTTGTAGTGCCAATTTTCATTTATATCAATTCAAAATACTTATAATGGCAGTTTTTTTATTTTTTAACTTGTCATTATATTATATTATGTTACTCAAATGTTTTTGAGAAAATTCTCGTGTGCATTTTTCTTATTAGGAAGCCACACTGAGGTTCTTCAAAAATGTTTTCATGTTGTCTGCTTACTAATTCAAAATGAAGTTAGAAAAACCTTTACATTTGAAAGGTTCATCTATTAAACTTTTTTTTTTTTGCCCCACTTTCAGAAAATGGATATCAGTGGAGTCAAGGTTTTAGAGACGGCAGATGACATCCAAGAGCGCCGA[C/T]AGCAGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGCAGACAGAAACTCGAAGACTCTTACCGGTTCCAGTTCTTCCGTCGGGATGCAGATGAACTTGAGAAATGGATCCAAGAGAAGCTACAGATTGCCTCTGATGAGAACTACAAGGACCCCAGTAACCTGCAGGTGAGAGAAGAAGCAAAGTCTACTTTTCTAAGTCCCCATTGTACTTCGATTCATAAACAACTTGGTAGAATATGTTTAGAGAAATTAAGTCCTAAAATGTGCTGTCAGCTGACTCGCCTCTGATCATAAAGTAACTCTTGTTTTTAAGTTGTAAATTCCTTGATTGGGCTTGTCTGTAATCAGCAGTGAATGACTGTATAGAGTTATTACGTTATAAAAGCTTGAATACTGCAAATGGATAGAAGGGTGTATTTTGTATGATGATAAAATAATTAGAACTAAAATTAGACTTGGCAATGTTCCTTTAAAGAAATTCACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1515
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 37 2480 2 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 None None 543 2 57
ENSDART00000124913 Nonsense 37 443 2 10
ENSDART00000140267 None None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11366939)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13068304
GRCz11 21 13165292
KASP Assay ID:
554-1439.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGC[A/T]GACAGAAACTCGAAGACTCTTACCGGTTCCAGTTCTTCCGTCGGGATGCA
Long Flanking Sequence:
GTCTGTAATCTTCACTGTCCTGTCTATTAAAGGTGAAATCCACGGAAAAAAAATAAATTGTCACACATATTGAACAAAAATGCTCAAAGTTTAGACTTTGAGTGAGTTTTTGTACCATGCAGATTTTGTAGTGCCAATTTTCATTTATATCAATTCAAAATACTTATAATGGCAGTTTTTTTATTTTTTAACTTGTCATTATATTATATTATGTTACTCAAATGTTTTTGAGAAAATTCTCGTGTGCATTTTTCTTATTAGGAAGCCACACTGAGGTTCTTCAAAAATGTTTTCATGTTGTCTGCTTACTAATTCAAAATGAAGTTAGAAAAACCTTTACATTTGAAAGGTTCATCTATTAAACTTTTTTTTTTTTGCCCCACTTTCAGAAAATGGATATCAGTGGAGTCAAGGTTTTAGAGACGGCAGATGACATCCAAGAGCGCCGACAGCAGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGC[A/T]GACAGAAACTCGAAGACTCTTACCGGTTCCAGTTCTTCCGTCGGGATGCAGATGAACTTGAGAAATGGATCCAAGAGAAGCTACAGATTGCCTCTGATGAGAACTACAAGGACCCCAGTAACCTGCAGGTGAGAGAAGAAGCAAAGTCTACTTTTCTAAGTCCCCATTGTACTTCGATTCATAAACAACTTGGTAGAATATGTTTAGAGAAATTAAGTCCTAAAATGTGCTGTCAGCTGACTCGCCTCTGATCATAAAGTAACTCTTGTTTTTAAGTTGTAAATTCCTTGATTGGGCTTGTCTGTAATCAGCAGTGAATGACTGTATAGAGTTATTACGTTATAAAAGCTTGAATACTGCAAATGGATAGAAGGGTGTATTTTGTATGATGATAAAATAATTAGAACTAAAATTAGACTTGGCAATGTTCCTTTAAAGAAATTCACTCGACTCAAAAGTGATGTTTGATGTTTGTTCAAACTACTTATTTACATTGAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4158
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 38 2480 2 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 None None 543 2 57
ENSDART00000124913 Nonsense 38 443 2 10
ENSDART00000140267 None None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11366942)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13068307
GRCz11 21 13165295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGCWGA[C/T]AGAAACTCGAAGACTCTTACCGGTTCCAGTTCTTCCGTCGGGATGCAGAT
Long Flanking Sequence:
TGTAATCTTCACTGTCCTGTCTATTAAAGGTGAAATCCACGGAAAAAAAATAAATTGTCACACATATTGAACAAAAATGCTCAAAGTTTAGACTTTGAGTGAGTTTTTGTACCATGCAGATTTTGTAGTGCCAATTTTCATTTATATCAATTCAAAATACTTATAATGGCAGTTTTTTTATTTTTTAACTTGTCATTATATTATATTATGTTACTCAAATGTTTTTGAGAAAATTCTCGTGTGCATTTTTCTTATTAGGAAGCCACACTGAGGTTCTTCAAAAATGTTTTCATGTTGTCTGCTTACTAATTCAAAATGAAGTTAGAAAAACCTTTACATTTGAAAGGTTCATCTATTAAACTTTTTTTTTTTTGCCCCACTTTCAGAAAATGGATATCAGTGGAGTCAAGGTTTTAGAGACGGCAGATGACATCCAAGAGCGCCGACAGCAGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGCAGA[C/T]AGAAACTCGAAGACTCTTACCGGTTCCAGTTCTTCCGTCGGGATGCAGATGAACTTGAGAAATGGATCCAAGAGAAGCTACAGATTGCCTCTGATGAGAACTACAAGGACCCCAGTAACCTGCAGGTGAGAGAAGAAGCAAAGTCTACTTTTCTAAGTCCCCATTGTACTTCGATTCATAAACAACTTGGTAGAATATGTTTAGAGAAATTAAGTCCTAAAATGTGCTGTCAGCTGACTCGCCTCTGATCATAAAGTAACTCTTGTTTTTAAGTTGTAAATTCCTTGATTGGGCTTGTCTGTAATCAGCAGTGAATGACTGTATAGAGTTATTACGTTATAAAAGCTTGAATACTGCAAATGGATAGAAGGGTGTATTTTGTATGATGATAAAATAATTAGAACTAAAATTAGACTTGGCAATGTTCCTTTAAAGAAATTCACTCGACTCAAAAGTGATGTTTGATGTTTGTTCAAACTACTTATTTACATTGAGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23878
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Essential Splice Site 168 2480 4 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 Essential Splice Site None 543 4 57
ENSDART00000124913 Essential Splice Site 168 443 4 10
ENSDART00000140267 None None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11368803)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13070168
GRCz11 21 13167156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGTACCTCCGTGAGTGTGAGGATGCCCTAGACTGGATCAGTGACAAG[G/A]TAAAAAGCGGCGGTTAGACATGTTCTGTTGTGCAGTAGATAATTTGCGTC
Long Flanking Sequence:
GTTTGAGCTGACTTGAATATGGGGGCCTTTATTGAGCCTTTCTATTACTGACTTTCTTTTTTTCTTGACTTTAGCTGTGCTGTCTTTTAAAAAATCACTAGCTATGTTTCCATCCACTTATTTTCATGTGCACTTTTAAATATCGCATAAAATCTGCTTCATGGATATGCCAAGATTTATTAGGAAGTGACTATTAGGTTGTCTTTGACTCATTGGATGGAAAGGGTGCTTTTTTCGCAAATGTTTTATGAGATTTTCCATAATCTCATTTGCATCTTTGGATGGAAACAAAGCTATTGTCTATTAGAAACAGAGCATTTGGTGTGTATCCTAACTGTTTGTCTCTACGTGAAACTCAGACCCGTCTAGAGGAGCTTCACCGTCTGTGGGACTTGCTGCTGCAAAAGACTAAAGAGAAGGGAATCCGTCTCCTGCAGGCCCAAAAACTGGTTCAGTACCTCCGTGAGTGTGAGGATGCCCTAGACTGGATCAGTGACAAG[G/A]TAAAAAGCGGCGGTTAGACATGTTCTGTTGTGCAGTAGATAATTTGCGTCAATACAAAAAAATACCAACAACCATGCCTAAAACACACCAACACACAAACAAAATGTTCTTGCAGGAAGCTATTGTCACCTCAGAGGAGCTTGGGCAGGACCTGGAACATGTGGAGGTCTTGCAGAAGAAGTTTGAAGAGTTCCAGACCGATCTGGCAGCCCATGAAGAGCGTGTGAATGAGGTGAACCAGGCAGCCGGCAAACTAACCCAGGAGAACCACCCAGAAGCTGAGCTCATCCTGAAAAAGCAGGAGGAGGTGAACTCCGCCTGGCAGAGGCTGAAGGGCTTGGCTCAGCAGAGGCAGGGCAAGCTGTTTGGAGCTGCTGAAGTGCAGCGTTTCAACCGGTGAGTTAAAGACCATAACATTTTTTGGGGGTTTTTCGAATTTAAAGGGGTGGTTTACTACGATATCACATTTTAAACTTTTGTTGTTGTGCAATGTAGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23879
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 1091 2480 23 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 None None 543 23 57
ENSDART00000124913 None None 443 None 10
ENSDART00000140267 None None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11383503)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13084868
GRCz11 21 13181856
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGCTAGAGTTGGGAGAGAAGAGGAAGGACATGCTGGAGAAGAGCTG[C/A]AAGAAGTTCATGCTTTTCCGTGAGGCGAACGAGCTGCAGCAGTGGATCAA
Long Flanking Sequence:
AGAATATAGGATACCAATAACTCTTTGCTTTAGTTTTTGTAAAACACACGCAGGCCCCAACTGCAATAAACCAGCTTTGGGGGGACCCAGCTTGCAAAAGGTTGAGAACACCTGCTTTACATAATGACCTAAAATAAACAACGACTTTTTATTTTCCTTATTTCTTAGTACATAATGTAACTACAGAAGAGTCAAGCTTTAAATGGGACAATTATCGAAACTTATTTTGAATGAGATGCTAATGGTCTAATCCGTTTTAATGATTTATGCTAAGCTAAGCTAAAAGTGACCCACCAGATATTGAGATCAGCTGAATAGATTTAAAAATGGTTAAACTCAACTCTTTAACTCTAATGGGGTTGAAAAATGAGCCAAAAAAAGCATGGAGTGTTTCTTTAATATGTGAGTATTTCTCTATTCATCCCTCTTTCCTTTTTTAACAGGTATGGTACACTGCTAGAGTTGGGAGAGAAGAGGAAGGACATGCTGGAGAAGAGCTG[C/A]AAGAAGTTCATGCTTTTCCGTGAGGCGAACGAGCTGCAGCAGTGGATCAATGAGAAAGAGTCTGCGCTTACTAACGAGGAGGTGGGATCTGACCTGGAGCAGGTGGAAGTGCTGCAGAAGAAGTTTGATGACTTCCAGAAGGTATGTTTCTTTTATAGATCTGTGACGTGGCCTACTATTAAGTTAAAACAAATGTTGCCCGAGTTTAAACACTTGTATTTTGTTTATTGTTTACCAGGATCTGAAAGCAAATGAGTCTCGGCTGAGGGACATAAACAAGGTGGCGTCTGAGCTGGAGTCTGAAGGTCTGATGGCAGAAGAGGCTCCTGTGGTTCAGGCCCAGGTGTGAAAAAAACAACAATACACCGTTAAACACACAATTTTGATAAAAAGTTTGGGGTCGCTAAGATTTTTGTTTGTTTATTTTTTTTAGTTTGTCATGGGGGCCAGTTCATGAAAAGCATGTTAAATGAGGGGCTGGAGACATATGACTTGTAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4161
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Essential Splice Site 1212 2480 27 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 Essential Splice Site None 543 27 57
ENSDART00000124913 None None 443 None 10
ENSDART00000140267 Essential Splice Site 45 179 3 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11386032)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13087397
GRCz11 21 13184385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCTGTTCGCTTGGCTGTTCAAACAACGGCCAACTTTAATACTATCAAG[G/A]TAAGATTCTAGGATCTTCGTATCCRTCTTTAGACCTTCCCTCAACCCAAC
Long Flanking Sequence:
CACAATCCCTTCATCCCACCATCAGCAAGTAGAGGTGCTGGGCTCAGCTCCTGGCAAGGTCACTATTGTTTAATGTCATTCATGTCGTCTCTTCAAGATCATCTGCATGCCTGCATGAAACAAACACAAATATTGTGATTTATTTATTTTTTGACTTGTACTAATTATTATTATATTTTATTTTGCAGGATGAAGCAGACTCCAAAGGTGCATCTCCATGGAAGGTAATATAGCTTAACGTTTCTCTCATTCTCATATTATTCCCATGATCTAATCTTGGTTTCAATTTAGTCATTTGGGTATTGTTTAACCTTTATGTCATCCACAGTGGTTTTTGGTGACTCAAAATGACAAAAACAATCTGGTTCTTTTATTCATAGTGACACACTCTTGACTGGTGTCTTCTGTTCTTTTCCTACTCTCTGTCTGTTAATTTATCCAACTCAATATAGTCTGTTCGCTTGGCTGTTCAAACAACGGCCAACTTTAATACTATCAAG[G/A]TAAGATTCTAGGATCTTCGTATCCGTCTTTAGACCTTCCCTCAACCCAACCCACTAAATCCTGCATTGTGCCTTTTGTACCTGGAGGACTAACTCATCGTGGTGTTCTTGTATTGGGGTTCCCTGTGTCCCATCACTGAACCATCGGCTGTGCAGTTGCATCCGCTTTATTTCCATTCACAAGTCCTTGTTGAGCATTTGAATTAACTCCTTTGTGTCTTGATGTTTTGGTGGTGGTCAAACAGAAATTCCAGAATGCATTATTTAACGCTTCTTTTTCAGTTTATGGCCGATGCATCCACCAACGATTTTATTTTGTCTAACTTTCATCACTCATCCCACATGCTTAAATGTTGTAGACGTTCTGTTTGTGTTGCTTATTTAGGGCTGGGTGGTATGACCAAAGTTCTACTTTACGGTGTTAGTCATCTGATTTTAAGGGATATTTTTATGTTGTATTTACCTAATTGGGTTGTTAAATCTTAGAAAAGCAACAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23880
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 1406 2480 32 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 None None 543 32 57
ENSDART00000124913 None None 443 None 10
ENSDART00000140267 None None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11390225)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13091590
GRCz11 21 13188578
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGATCGACGCTCGTGCAGGAACCTTCCTGGCTTTTGAGCAGTTTGGA[C/T]AGCAGCTGCTCGCTCGTGGGCATTACGCAAGCCCTGAGATCAAACAGAAG
Long Flanking Sequence:
AAACCAACAACTTAATAATATAGAACAGGGGTGTCCAAACTCGGTCTGGAGGGCCGGTGTCCTGCATAGTTTAGCTCCAACTTCCTTTAACACACTTGCTTGTGAATTTTTAGTATACCTAGAAAGAGCTCGATTAGCTGGTTCAGGTGTGTTTAATTGGGGTTAGAACTCAAATATGCAGGACACCCGCCCTTCAGAACAGAGTTTGGACACCCCTGATATAGAAGATACTTAACAAATCTGTTCTCTCTCCTTCAGAGATCTCATGTCTTGGATCAATGGAATCAGGGGACTTGTGTCTTCCGATGAGCTGGCCAAGGATGTTACTGGTGCTGAAGCCCTGTTGGAGAGACATCAGGTGCGTAAAAACACCTATACAGCATTGCAGAAGAGTTTTCCTTAACATCTTTTTAATACACTGACATGTTCACATTGTGTAGGAACACCGCACTGAGATCGACGCTCGTGCAGGAACCTTCCTGGCTTTTGAGCAGTTTGGA[C/T]AGCAGCTGCTCGCTCGTGGGCATTACGCAAGCCCTGAGATCAAACAGAAGCTGGAGGCTCTTGACCGGGAGCGTGCTGACCTGGAGAAGGCCTGGGTTCAGCGCAGGATGATGCTGGACCAGTGCCTGGAGCTGCAGGTCAACAGAAACCCTTGAGTACATCTCATACAACTCTTGGATGTTTGAAGATGTTTCCCTCAAATGATGCCATGTTCCTTTTTTGTCTCCCTCAGTTGTTTAACCGTGACTGTGAGCAGGCTGAGAACTGGATGGCTGCCCGCGAAGCCTTCTTAGCCAGCGATGACAAGGGAGATTCTCTGGACAGTGTGGAGGCGCTCATTAAGAAACACGAGGACTTTGATAAGGCTATCAATGTGCAGGTCAGACGATCATATGATCAAGTTCTAAATCTTTGAATTGTTTGAATGTTTTTATTCAGAACTAATCAATTCAATTCATGAATTCTCACAGGAAGAAAAGATTGCTGCACTGCAGTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23881
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 1648 2480 38 56
ENSDART00000102253 None None 475 None 11
ENSDART00000102256 None None 543 38 57
ENSDART00000124913 None None 443 None 10
ENSDART00000140267 None None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11395525)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13096890
GRCz11 21 13193878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTACATTGTTTTGTTTTCAGGCTCGTCTGAATGCTCTGGACGAGCAGTG[G/A]CAGTTCCTGGTCAACAAGTCTGCTGAGAAGAGTCAGAAACTGAAGGAGGC
Long Flanking Sequence:
ACCGGGTGGTTTGGAGTTAAAAAGCGTACTAGAAGTTTAAATAAGATATCATTATTCACTTTGAAGTGCTCACGATAACAATACCATGCATGTTCATTATTGCAATATAGTGTATTTTTGAATATGAATAGACAATACATCTAGATATGAGAGCTATTGCATTTTTCACAGCTGCAGCAATGCATGACTTCACCGTGTGGCTCAGTTTTGCCATATTTCGCTTTTCCCGCCACTTTCAGAGCAAACACCAGAAACACCAGGCTTTTGAGGCTGAGCTACACGCTAACGCTGATCGTATCCGCGGAGTGATTGACACGGGCAATGCTCTCATCCAGAGAGGTGCCTGTGCTGGAAGTGAAGATGCTGTTAAGGTAACGCTTTCGGAGATTTTTCAGATATCGGGAGCGAGCTGGTGGTATTCGGTCCGTGCTCATTTTTGCTGTGGTCGTGCGTACATTGTTTTGTTTTCAGGCTCGTCTGAATGCTCTGGACGAGCAGTG[G/A]CAGTTCCTGGTCAACAAGTCTGCTGAGAAGAGTCAGAAACTGAAGGAGGCCAACAAACAGCAGAACTTCAACACTGGCATCAAGGACTTTGACTTCTGGTTGTCTGAGGTATTGATATGGGACTTATTAGCTACTTGGAATAGTTTGCATAATATTTATGATGAAGTATAATAGTGTTAGTTGATTTAATTATATTTATTAATGATAAGGGTTGTTATTGTTACTAGTTGGTAGGAACTTGTGTATGTAAAAATGTTTGTGTAATAATAATAATCATCATTATTTTTCTTATTATTAATTAATATTATATATCAATGATTATAGTATTATTAGATTATGTATTTATAACTGTTATTAATATAAATAATCAATTAATATAAATAATTTCATTATTGATAATAATTAATATAATAATATATCCCAATTAATTTGTATTGTTGAAATAATCATTTATAGTTTTATTATATAATAATGATTATTATTATTATGTAAATTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45731
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 2177 2480 48 56
ENSDART00000102253 Nonsense 151 475 2 11
ENSDART00000102256 Nonsense 219 543 48 57
ENSDART00000124913 None None 443 None 10
ENSDART00000140267 None None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11408031)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13109396
GRCz11 21 13206384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGATCGGCAGATTAAGAGCTACAACGTGGTGTCCAACCCATACACCTG[G/A]TTCACCATGGAGGCTCTGGAGGAGACCTGGAGTAACCTTCAGAAGATCAT
Long Flanking Sequence:
CCTTCCAGCAGGAGGGCATCACCAACATCACAGCTCTAAAAGACCAGCTGCTGGCAGCCAAACATGTGCAGTCTAAGGCCATCGAGGCTCGTCACGCCACCCTGATGAAGCGCTGGAACCAACTACTATCCAACTCAGCAGCCCGCAAGAAGAAGCTTCTGGAAGCACAGGACCACTTCAGAAAGGTATGAAGAACGCAAATGTACCTGAAAGAAAACTATTTATTTGGTTTGCCTTCAACTCTTGTTCTCCATTCAGGTGGAGGATCTTTTCCTCACGTTTGCCAAGAAAGCCTCAGCCTTCAACAGCTGGTTTGAGAACGCAGAGGAAGATCTGACCGATCCTGTGAGGTGCAACTCTCTGGAGGAGATTAGGGCACTGCGGGATGCCCATGATGCCTTCCGCTCGTCCCTGAGCTCCGCAGAGGCCGACTTCAGCCAGCTGGCAGAACTCGATCGGCAGATTAAGAGCTACAACGTGGTGTCCAACCCATACACCTG[G/A]TTCACCATGGAGGCTCTGGAGGAGACCTGGAGTAACCTTCAGAAGATCATCAAGGTGAGGCGGAGTTTCTTTGTGTGTATGAAGTGTTTGCTATTAGATGGTATGATATTGGGCTACATTACATTTTCTGTTTGGAATATTCAGCAGTGAATTTGATTGAACTAAAAAAGGAAAGAACCAGAAAACAAAAGACAGACAGAAAGTAAGGTATAAAAATAATGGAACAATTAGAACGACAGATAAAGTGTACCATTTAAATAATTTTATACATTTTTCTGTGAATGAATAATTTAAAATTAATTTGATTAACACAGAATTAATAAATATTATGAATATTACTTTATTACCAAATAAGTATCTAATATGGCAACAAACGATCAAGATATTGTTAATATATGTATCAATTACTTCTAACTTTGCTGGTATCACACATAGTGCTGTTTAACAATTAATCACCTCTAATTCCAAATAAAATAAAAGTTTGTTTACACATTACAATT
Associated Phenotype:
Not determined