Busch Lab

ZMP

mogat2

Ensembl ID:
ENSDARG00000019228
ZFIN ID:
ZDB-GENE-041010-186
Description:
2-acylglycerol O-acyltransferase 2 [Source:RefSeq peptide;Acc:NP_001006083]
Human Orthologue:
MOGAT2
Human Description:
monoacylglycerol O-acyltransferase 2 [Source:HGNC Symbol;Acc:23248]
Mouse Orthologue:
Mogat2
Mouse Description:
monoacylglycerol O-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2663253]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa41689 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41688 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3773
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017436 Nonsense 88 252 4 6
ENSDART00000128888 Nonsense 204 368 4 6
ENSDART00000143301 Nonsense 166 330 4 6

The following transcripts of ENSDARG00000019228 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 33496433)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32597782
GRCz11 10 32541642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTGTGTGTATTCCAGGGCTGGTTCCATCAGACAAGGAGAGTGCCRGTTA[T/A]CTGCTCCGGAGGAAGGGYGGAGGGAATGCGGTGGTCATTGCAGTMGGTGG
Long Flanking Sequence:
AAACATTTACAAAATTCAGCGTACAGTACATTTTTCATTAGGAATTGAAGCTTTTAGATATGATAAAACCTTCCTTATATTATAAACCTTTTTGTGTCATTATTTTGGTGGTCAAAAGGACCCGGGGCTCAACACAGCGGAATGAACCACCAACTTATCCAGCAGGTTTTTACGAAGCGGATGCCCTTCCAGCTGCAACCCATCTCTGGGAAAAGAGCAGTTCAATCTCTTATGAAGTTTGCTGTATAAAAATATAACATTTTGAATTATTTATAATTATCGGCCTATACATATCAGCTATACGGCCTCCAAGTCTAAAGAGTTATCGGTTATCGGCCAAAAAAATCCATGTCGATTCATCCCTAGGTAAAGGCATTAGAAAATACAGTTTTACCAGCATAAAATCAATGGAAACCTATGTAACATCCCTACTGCTCACAAAAACAAACACGTGTGTGTATTCCAGGGCTGGTTCCATCAGACAAGGAGAGTGCCGGTTA[T/A]CTGCTCCGGAGGAAGGGCGGAGGGAATGCGGTGGTCATTGCAGTCGGTGGAGCTCCTGAAGCTTTGGATGCACATCCTGGTGACTACACCGTTCACCTGGCCAATAAGAAAGGCTTTATTAAGCTTGCAATAGAGCACGGGTAAGCAAGAGCTTTCTCCTGATCACTTAATAGTTTAACAGGTTGTCTCTTGTTGACACAAGATTTTGTCTTTTGTGTTTGTGCCAATTATTTGTTGCCAGATTGCCAAAGTTGCTCATTTATGAAATGCAAACTTGTGCAACTTGCATTGGAACGTAATAGTTCTACATTTACATAACGCTCTGTGGCAAAAACTAAAGAGTTTGAAGGGTTAGTTCACCCAGAAATGAACATTTATCATTCATTCTCATGTCATTCCAAACCCCTAAAACCATCATTCACTTTCAAAACACAAATGTGACCCTGGATTTGAATTGGGTTTATTTTTGGCAGTAACCAAAAATACATTATTGTATGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41689
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017436 Essential Splice Site 135 252 4 6
ENSDART00000128888 Essential Splice Site 251 368 4 6
ENSDART00000143301 Essential Splice Site 213 330 4 6

The following transcripts of ENSDARG00000019228 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 33496292)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32597641
GRCz11 10 32541501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCACCTGGCCAATAAGAAAGGCTTTATTAAGCTTGCAATAGAGCACGG[G/A]TAAGCAAGAGCTTTCTCCTGATCACTTAATAGTTTAACAGGTTGTCTCTT
Long Flanking Sequence:
ATGAACCACCAACTTATCCAGCAGGTTTTTACGAAGCGGATGCCCTTCCAGCTGCAACCCATCTCTGGGAAAAGAGCAGTTCAATCTCTTATGAAGTTTGCTGTATAAAAATATAACATTTTGAATTATTTATAATTATCGGCCTATACATATCAGCTATACGGCCTCCAAGTCTAAAGAGTTATCGGTTATCGGCCAAAAAAATCCATGTCGATTCATCCCTAGGTAAAGGCATTAGAAAATACAGTTTTACCAGCATAAAATCAATGGAAACCTATGTAACATCCCTACTGCTCACAAAAACAAACACGTGTGTGTATTCCAGGGCTGGTTCCATCAGACAAGGAGAGTGCCGGTTATCTGCTCCGGAGGAAGGGCGGAGGGAATGCGGTGGTCATTGCAGTCGGTGGAGCTCCTGAAGCTTTGGATGCACATCCTGGTGACTACACCGTTCACCTGGCCAATAAGAAAGGCTTTATTAAGCTTGCAATAGAGCACGG[G/A]TAAGCAAGAGCTTTCTCCTGATCACTTAATAGTTTAACAGGTTGTCTCTTGTTGACACAAGATTTTGTCTTTTGTGTTTGTGCCAATTATTTGTTGCCAGATTGCCAAAGTTGCTCATTTATGAAATGCAAACTTGTGCAACTTGCATTGGAACGTAATAGTTCTACATTTACATAACGCTCTGTGGCAAAAACTAAAGAGTTTGAAGGGTTAGTTCACCCAGAAATGAACATTTATCATTCATTCTCATGTCATTCCAAACCCCTAAAACCATCATTCACTTTCAAAACACAAATGTGACCCTGGATTTGAATTGGGTTTATTTTTGGCAGTAACCAAAAATACATTATTGTATGGGTCAAATATAATTTTTTATTTTATGGCAAAAATCATTTGAATTTAACGTTAAGATCAAGTTGTATAAATACATTTAGCAAATTCCCTACAGTAATTTTTACAAAAGTCAAATTTGCATTAGTTAATGTGCATTGCTGGGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41688
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017436 Essential Splice Site 135 252 5 6
ENSDART00000128888 Essential Splice Site 251 368 5 6
ENSDART00000143301 Essential Splice Site 213 330 5 6

The following transcripts of ENSDARG00000019228 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 33494017)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32595366
GRCz11 10 32539226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTCGCTTCTGTTTTTAATCAAAACTATCTTATTTTATTCTTACTGTA[G/A]TGCAGATTTGGTTCCTATATATTCGTTTGGAGAGAACGAGGTGTTTGACC
Long Flanking Sequence:
AAAAAAATGTGTGTGACAAAATTCTGTAAACAAGACTGTGTTTGCTAAAGAGATTAACAGTTTTTCTTTATTTTGCCATGAAAAAGTGTTCTTGGAGTTTAGTATCATTCAGAAATCACATTGTTTTAATGAAGGGTTTGGTTCCTTTTCTGGACTTTGAACATATCTAGAACTTTACCGTCTATGGAGGGTCATCTAAAATAAGCATTTTGTTTAAATTATATTGATTTGAGTAATTAAGAACAGAACTTTCAATTTTGGGTTAACTAATCATTTAGCAATCTGTACATTCTACCAATGACATAATTTCAATGTCAAGATTCACATCTGCATTAGATTTTTGTCTGCAAATTTGATTCTGACATTCTACTTTCAGATAGTTTATATGTTAAATCTGCACATGAATGTTTCATGTCTCTTTATTTATTTCATTTGTAGACATTATTTTCCTCTCTCGCTTCTGTTTTTAATCAAAACTATCTTATTTTATTCTTACTGTA[G/A]TGCAGATTTGGTTCCTATATATTCGTTTGGAGAGAACGAGGTGTTTGACCAGGTGCAGAATCCTCGTGGCACATGGCTGCGATACATTCAAGAGCGTCTGCAGCGCATCATGGGTGTTTCTCTTCCTCTCTTTCATGCGCGAGGAGTTTTCCAGTACACCTTCGGCCTGATGCCTTACAGAAAGCCCATCAACACTGTTGGTGAGTACAAGCAAATATTACTGAAACTTTATTAAGACTAATTTCAAACGACCCTTTGTCATGCTATACAGATGAAATGACCTCTCTCAGTTTTCTGAGTCATGTATTTTTTGTAGTGTAGAAATGCTTAATCTTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTAGTCTGTCTGTCTGTCTGTCTCTGTCTCTGTCTCTGTCTCTGTCTG
Associated Phenotype:
Not determined