Busch Lab

ZMP

zgc:101661

Ensembl ID:
ENSDARG00000019156
ZFIN ID:
ZDB-GENE-041114-150
Description:
HAUS augmin-like complex subunit 5 [Source:RefSeq peptide;Acc:NP_001007439]
Human Orthologue:
HAUS5
Human Description:
HAUS augmin-like complex, subunit 5 [Source:HGNC Symbol;Acc:29130]
Mouse Orthologue:
Haus5
Mouse Description:
HAUS augmin-like complex, subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1919159]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14678 Nonsense Available for shipment Available now
sa13201 Nonsense Available for shipment Available now
sa34377 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14678
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025356 Nonsense 28 641 1 19
ENSDART00000056629 Nonsense 28 692 1 20
Genomic Location (Zv9):
Chromosome 8 (position 21452652)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20882549
GRCz11 8 20914634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGTWGAGGAGCTTGAGCTGCCAGCATCCAGACTCCCGGACGACGGCTA[T/A]ATGAARACGTYAGTGGGCTSCYAACTYAGRATGAATTATARTTATKYATC
Long Flanking Sequence:
AATATTGTGTCATGTTTGTATCATGTAGGCCAGGGGTGCCCAACTCTGTCATTGAGGGCCGGTGTCCTGCTTATTTTAGTTCCAACCCCAATTAAACACACCTGAACCAGCTAATCAAACTCTTTCAAATATTAAAACTTCCAGGCAAGTGAGATGAAGGAAGTTAGAGCTAAACTATGCAGGAGCGAGTTTGGACCCCCCAGTGGGCTCAAAAGTATTTTAATGCTGATGTTGAAGTAACTTGTTGTCCAGTAGGGGCAGCATCGGCCCCTGTAATGACAAATCGCAAAGTAAACAGGAGCGAAGAAACGTCTCCCGCGTATTTTGATCTGTCTTTTCCGTATCCGATGCGTACATTGTAATATGATGTGAGTTTGAAAGTTTTAGGTTTGTTTTATTATCAAGTGACTGAAAAAGATGTCGAGTCTCAGTCAGGAACTGAAGCGCTGGGCTGTTGAGGAGCTTGAGCTGCCAGCATCCAGACTCCCGGACGACGGCTA[T/A]ATGAAGACGTCAGTGGGCTGCTAACTCAGGATGAATTATAGTTATGCATCTTTATCAACGTGTTTAAGCTGATCATGTGTTTAAATTTGTCTTTAGATTGTGCGTCGGTCCTGGAGCATCCATTTGGAAGTATATCACACAACATGTTTATAAAGAGAGGTTAGATCTCGTTTGATCTCTAATGCTTGTTTTTGTTTACAATAATGCAACATTCAACATGTAATATATGTTCACAGGAATGTTCGGGTGGTGCGGGGGAATATCCAGTGGTATCCTTTACATTTTCTGACAATGAAACAATGTGACAATGTGTGCTGTTGTTTACAGTGCATTAAGTATTGTTAACAAATTTAGTAAGGATTTTTATTATGTAAAATAAAACAGTTACAGTAGAATTTAGTTAAGCTAACAGTGGAAATGTTATTGTGAAGTGTTTTAAATTGAGGATACTTTAGTTCAATAATTTGTTCAAATTTAAATACAATATACGGCACAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13201
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025356 Nonsense 43 641 2 19
ENSDART00000056629 Nonsense 43 692 2 20
Genomic Location (Zv9):
Chromosome 8 (position 21452519)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20882416
GRCz11 8 20914501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATTTGTMTTTAGATTGTGCGTCGGTCCTGGAGCATCCATTTGGAAGTA[T/G]ATCACACAACATGTTTATAAAGAGAGGTTAGATCTCGTTTGATCTCTAAT
Long Flanking Sequence:
AAAACTTCCAGGCAAGTGAGATGAAGGAAGTTAGAGCTAAACTATGCAGGAGCGAGTTTGGACCCCCCAGTGGGCTCAAAAGTATTTTAATGCTGATGTTGAAGTAACTTGTTGTCCAGTAGGGGCAGCATCGGCCCCTGTAATGACAAATCGCAAAGTAAACAGGAGCGAAGAAACGTCTCCCGCGTATTTTGATCTGTCTTTTCCGTATCCGATGCGTACATTGTAATATGATGTGAGTTTGAAAGTTTTAGGTTTGTTTTATTATCAAGTGACTGAAAAAGATGTCGAGTCTCAGTCAGGAACTGAAGCGCTGGGCTGTTGAGGAGCTTGAGCTGCCAGCATCCAGACTCCCGGACGACGGCTATATGAAGACGTCAGTGGGCTGCTAACTCAGGATGAATTATAGTTATGCATCTTTATCAACGTGTTTAAGCTGATCATGTGTTTAAATTTGTCTTTAGATTGTGCGTCGGTCCTGGAGCATCCATTTGGAAGTA[T/G]ATCACACAACATGTTTATAAAGAGAGGTTAGATCTCGTTTGATCTCTAATGCTTGTTTTTGTTTACAATAATGCAACATTCAACATGTAATATATGTTCACAGGAATGTTCGGGTGGTGCGGGGGAATATCCAGTGGTATCCTTTACATTTTCTGACAATGAAACAATGTGACAATGTGTGCTGTTGTTTACAGTGCATTAAGTATTGTTAACAAATTTAGTAAGGATTTTTATTATGTAAAATAAAACAGTTACAGTAGAATTTAGTTAAGCTAACAGTGGAAATGTTATTGTGAAGTGTTTTAAATTGAGGATACTTTAGTTCAATAATTTGTTCAAATTTAAATACAATATACGGCACAATATATATTTAAATACGGCACAATTTATGTTTAAAGCCAAAAATAAATTACTTCCGAAATGCACACTAAAGTTATTTTATGAAAGACAAGGGGGATATAATCTGAGAGAAGAACTGAATCTTAGGAGGTTGAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27179
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025356 Nonsense 264 641 10 19
ENSDART00000056629 Nonsense 264 692 10 20
Genomic Location (Zv9):
Chromosome 8 (position 21447561)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20877458
GRCz11 8 20909543
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCACCAAACCAAGTGCTTTCAGCTTTGCAAGCCTTGACCTCCAGACAT[C/T]AGGTGGCATTGGAGGAGAAGATCACTGCTTTAAATTTGGAGCGTGACGTT
Long Flanking Sequence:
CAGCAACTCCCATTAGGGCTTAATAGAAACAAGTTGACCAGTCAAAAGTGTCTTCATTGAATCTCATTTTCTCTCTGATTGGGAATTATGAAATACCATTTCTGTCTCATTTCAGAAGGATGTGAGAGAGCTCTGCAACGAGAGGGTTCACTTCCTCCAGTGCCTGCTGGAAAGCGAGCTAAAAGCAAATCCATCCACGCAGTAAGAAACACAGGCTTCTGATGGTGAAATTACAGATAGTTGAGCCTGAGTGTTGTTTCCTCATAGATCCCAATTCATTTGTTTACACCCAGATTTACTCGAGATCAAAGGCATGCTGTGATCCAGCACTGGACAAGTGCTGTGGAGGTAGTGGACAATACTTTGTGTCTTTATGCAAATGTTTTTGTTCCACACATCACCTAATGAAAACCTCTACATGTTTGATTCCTCAGAATGTTTTACGATCTCATCCACCAAACCAAGTGCTTTCAGCTTTGCAAGCCTTGACCTCCAGACAT[C/T]AGGTGGCATTGGAGGAGAAGATCACTGCTTTAAATTTGGAGCGTGACGTTTCAGCTTTAGGGTGAGTTTGTGTAACATGATGTATATTAACAAAAACACCCACATTATCTCTTTATAAATTTGTGTATTATTGTATTTATTGCAGGTTTCGTTATGAGAGCGATCACCTAATAGATGTGTCTTCTGAGCTTGAGGAGTTAACTCCTGTCCGCAGTCTGTTACAGGTGATCGTTTGAGATAGTGTTCTCTTTTCTTATAGTGTATTTTACTTTCTGTGTCGTAAGGCTGATGTTGTACGGCAAATCTGCAACATATTGCTGGAGTAACATCTGTGTTGATCCTGGAGCAACATTCCAGTCAACCAATCTGATTTAAGGGAGAACTTTAAAGTTTAGACTTTCAATCAGTGTTATGTGATTTTACATCAGTGTTATTAACCTACAGTTTCCTCTGGTTTTAGCACTAATTTAGATTAGGTTTTAAATACATTTTTAAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34377
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025356 Missense 634 641 19 19
ENSDART00000056629 Essential Splice Site 633 692 None 20
Genomic Location (Zv9):
Chromosome 8 (position 21436099)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20865996
GRCz11 8 20898081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCGGAGATGGAGAGAGAAGGACTGACCTTCCAGCAGTGGCTCCAGAGG[T/C]GGAGACTTGCTACTAAAGAATCCTGACTTAGCTCTGCATAAAGTGAAGTT
Long Flanking Sequence:
TTAGACTAATGGTAAAGTTTTGAGTTCTGAAACTTACAGGCTGTTTTTATAGTCCAGTACCTCATGAATGGCAAAAGATGTAGTCAAATTTGGAATTCTCATTTTATGACCTGTTGAAGAACTGACAACCTTATTTCCTTAGCTTTCTTTCCTGACTTCAGGGTATTGTGAACGGTTAAAAACCAGTTGTGTTCTTGTGTTTCAGCTTTGCTGCAGCGAGTGAAAATGGAAGATGAGGAGATTCTGCAGACGCTGCTCCCTCGGGCTCGTGAGCTCATGCACAGGTGCTCTAAAGGCCTGCTTTACTCTGAACAAGTGAAGACTGCCATCACACACTGGTGAGACAAGACACTCTACAATGACTACAATATTAGACCATGTCTATTACAGCGCCATATTAATGCCGTTTGATTTGTTTGTGCAGGTGGGATCAGCCTGCTCAGTTTGCGCTGCCGGAGATGGAGAGAGAAGGACTGACCTTCCAGCAGTGGCTCCAGAGG[T/C]GGAGACTTGCTACTAAAGAATCCTGACTTAGCTCTGCATAAAGTGAAGTTTACATGCATCTGTACACCGTTCACACTTTATCAAATCTCTCTTGCCTTTGAATAACCTGATAAGTAGTATAGTTTTCTAGTTATTACCCTGTTCAGTTGTTTGTACATCCCTATTCAAGAAATATTTTGGGCACTTTTTAATGAATTTCACAATAAATAAGCAATAATAGACACTGGAATAAGAGAGCAGATTCATGACTTGTTTTCTGGTATTCTATATTTGATTATTCCTTTTTCTTCAGCTTGGTCCCTTATTTATTAGAGGTTGCCACAGTGGGGTGAACCACCAACTATTCCAGTATATATTTTATGCTTATGCCCATCCAGCTGCAACGCAGTACTGGCAAACACTTGTACACAACAGCCTATTTAGTTAATCCTATTTACCACGACTTTATGGGGAAACTGGAGCACCCAGAGGAAACCCACACAGACACGGGGAGAACATGC
Associated Phenotype:
Not determined