Busch Lab

ZMP

snx12

Ensembl ID:
ENSDARG00000019060
ZFIN ID:
ZDB-GENE-040426-787
Description:
sorting nexin 12 isoform 1 [Source:RefSeq peptide;Acc:NP_957417]
Human Orthologue:
SNX12
Human Description:
sorting nexin 12 [Source:HGNC Symbol;Acc:14976]
Mouse Orthologue:
Snx12
Mouse Description:
sorting nexin 12 Gene [Source:MGI Symbol;Acc:MGI:1919331]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23971 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23971
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003335 Essential Splice Site 55 162 None 4
ENSDART00000126678 Essential Splice Site 55 153 None 4
ENSDART00000133478 Essential Splice Site 55 160 None 6
ENSDART00000140811 Essential Splice Site 55 283 None 5
ENSDART00000147375 Essential Splice Site 55 151 None 6
Genomic Location (Zv9):
Chromosome 21 (position 29215295)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30434539
GRCz11 21 30471234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATAGGAGTCGGTCGTAATCGCTTCACCACCTACGAAGTCCGGATGAGGG[T/A]AGGCCGAATAACCGTAATTGTGTGTTTGTTCCGGAGAGGCTGCGGCTCGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29625
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003335 None None 162 None 4
ENSDART00000126678 None None 153 None 4
ENSDART00000133478 None None 160 6 6
ENSDART00000140811 Nonsense 204 283 5 5
ENSDART00000147375 None None 151 6 6
Genomic Location (Zv9):
Chromosome 21 (position 29228407)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30447651
GRCz11 21 30484346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCACATCAGTCAAAGCCTTTCACAGCTGCTGTCCCCTGATATCCTGTA[T/A]ATATTTCTATTCTCGAATAGAACTAAACGACAGCATCTGTTCCACCCTGA
Associated Phenotype:
Not determined