Busch Lab

ZMP

wu:fc32f04

Ensembl ID:
ENSDARG00000019045
ZFIN IDs:
ZDB-GENE-030131-3273, ZDB-GENE-030131-3273
Description:
Wu:fc32f04 protein [Source:UniProtKB/TrEMBL;Acc:Q803F8]
Human Orthologues:
AC002365.1, AC003980.1, AC006062.1, AC006999.1, AC007379.1, AC008162.1, AC008573.1, AC008794.1, AC010133.1, AC011503.2, AC012596.1, AC016595.1, AC018553.1, AC022409.1, AC022486.1, AC023481.1, AC067941.1, AC091492.1, AC092485.1, AC097714.1, AC116351.3, AC145210.1, AL121899.1, AL138690.1, AL159986.1, AL357512.1, RBM25, TCHH, TRAF3IP1, ZC3H13
Human Descriptions:
RNA binding motif protein 25 [Source:HGNC Symbol;Acc:23244]
TNF receptor-associated factor 3 interacting protein 1 [Source:HGNC Symbol;Acc:17861]
trichohyalin [Source:HGNC Symbol;Acc:11791]
zinc finger CCCH-type containing 13 [Source:HGNC Symbol;Acc:20368]
Mouse Orthologues:
Gm10563, Rbm25, Tchh, Traf3ip1, Zc3h13
Mouse Descriptions:
RNA binding motif protein 25 Gene [Source:MGI Symbol;Acc:MGI:1914289]
TRAF3 interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921269]
predicted gene 10563 Gene [Source:MGI Symbol;Acc:MGI:3642630]
trichohyalin Gene [Source:MGI Symbol;Acc:MGI:2177944]
zinc finger CCCH type containing 13 Gene [Source:MGI Symbol;Acc:MGI:1914552]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
hu3565 Nonsense Available for shipment Available now
sa39429 Nonsense Mutation detected in F1 DNA Not yet available
sa44060 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
hu3565
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004357 Nonsense 122 672 5 8
ENSDART00000058357 Nonsense 128 757 5 9
Genomic Location (Zv9):
Chromosome 23 (position 45167820)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45492013
GRCz11 23 45205333
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGAGTCGACTAAAGTGGAAAAACAAGAAGAAGAAGAAAGCAGAAAAT[C/T]AGACTGAAGTGAAGAAACCCCCAAAATCAGCTAAAGATCCAGTGTCGAAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39429
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004357 Nonsense 240 672 5 8
ENSDART00000058357 Nonsense 246 757 5 9
Genomic Location (Zv9):
Chromosome 23 (position 45167466)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45492367
GRCz11 23 45205687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTGCTCACAGGAAACACGTGCTGAATAGGAAGATCATCTCCACGGCC[A/T]AGAAAAGGATTGATGCTGTTAATCACAGAAAGGTTTGCTGTCATTCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44060
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004357 Nonsense 593 672 8 8
ENSDART00000058357 None None 757 None 9
Genomic Location (Zv9):
Chromosome 23 (position 45163924)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45495909
GRCz11 23 45209229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAACGAGTCTGAAAAGAGAGAGGCAGGAAAGAGCGAGTCTGAAATGAAA[G/T]AGGCAAGAAAGAATGAGTCAGAAAAGAAAGAGGCCAGAAAGAGAGAGACT
Associated Phenotype:
Not determined