Busch Lab

ZMP

erp44

Ensembl ID:
ENSDARG00000019008
ZFIN ID:
ZDB-GENE-040426-1902
Description:
endoplasmic reticulum resident protein 44 [Source:RefSeq peptide;Acc:NP_957186]
Human Orthologue:
ERP44
Human Description:
endoplasmic reticulum protein 44 [Source:HGNC Symbol;Acc:18311]
Mouse Orthologue:
Erp44
Mouse Description:
endoplasmic reticulum protein 44 Gene [Source:MGI Symbol;Acc:MGI:1923549]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa516 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa516
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027545 Essential Splice Site 339 408 9 11
Genomic Location (Zv9):
Chromosome 16 (position 29652746)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27489884
GRCz11 16 27424507
KASP Assay ID:
554-0346.1 (used for ordering genotyping assays)
KASP Sequence:
TCGATAGTTTCCGCCACATGTATGTCTTCCCAGAGTTCAGCGACCTTGCG[T/A]AAGTATTGCACTTGTCAGTGTGTATTTAATGCAGAGATTATTTTAGCTTT
Long Flanking Sequence:
CTCTAATGGCAATGTGTCATACTTCCCATAGTAAACATGCACCGTTATGGAAGACAGCAAACAAATTTATTTTTTACAGTTTTTATTGTTTTTTATCATTTTAAAATGTAACTTTTTTTTTTTTTTCCATTTTGGCCTTCCGGCGGCACTGAAACTTTGTTGTTGTCAAAACAAACATAATTTTATCAAACACTGGAATAAAAATGACATTTTTTAGTTTAGTAGTGTGACAAAAAAACATATCCAGTTTGAAAATGTTAAGTTTTGCACATCCATAATCAAAATGTACTTTTAATGCTCATAGTGCTTTTCACAGATCTAAATGACAATATCTAAATGAATCTGGTTTTCCCTCAGGTTCTATAAATTTCCTTCATGCTGATTGCGATAAGTTCCGGCACCCTCTACTTCACATTCAGAAGACACCTGCCGATTGCCCTGTAATCGCCATCGATAGTTTCCGCCACATGTATGTCTTCCCAGAGTTCAGCGACCTTGCG[T/A]AAGTATTGCACTTGTCAGTGTGTATTTAATGCAGAGATTATTTTAGCTTTCACTCTATACGTACACACTTGTTATTGTATACTCAGTGCCACAGCAACACACACTGTGAGCGTGACAGAGCTTAAAGCAACACATGCTCTTTGGAAATACGTGCTTCAGCCTACATTTTTTTTAAACCACAATAGTGTGCTTCAACATACAGTGGGGGAAATAAGTATTGAACACGCCACCGCTTTTCTAAAAAAACCTATTTCTAAAGGTGCTGTTGCCTTGAAATTTTCTCCTGATGTTGATAACAACAAAGGAAATTTATATATGCAAATAAATTAAAGCTAATTAGTTTACAAATTCATTTATGGGTAATAAAATAAAATGACGCAGCAAAAAAGTATTGAACAAATTAAAAAATGGAGGTGTACAAAGATGGTGAAAATCTAGACAGCAGCTGAAATTTCTCAGTAGTTCTTCAGCAAACCCTCTGCCCTTTGTCATTGAAAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28671
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027545 Nonsense 356 408 10 11
Genomic Location (Zv9):
Chromosome 16 (position 29649323)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27486461
GRCz11 16 27421084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTCCAGGAAAGCTGAGGCAGTTTGTATTGGACCTGCACTCAGGAAAGT[T/A]GCACAGAGAGTTTCATCACGGCCCAGACCCCACAGACAGCACTCCAGGAC
Long Flanking Sequence:
TTGCTCTGCACCTGCATTGAGCCAGTTAACAGCAATGCCTCTCAAATACTGTAGCTGTTATATATGTGAACATGGCTTTTATACGTTTATAACCATGTTACTACTACTCTATTACAGCACTGCAATAATTTATGACACCAGAGGCCGTTTATGACAGAAAACATCATAATTCAGCGCATGCCTTATTTTATTAAGCACTCTGCTTATCCTGTTATCCAATTTGACTCTTATCAGCCTGCCTCTCATCAGACTCTGATACAGCTGATTGTCCAGGGGGTCCGTGGCGTCTGGGGCAGTACAGATGATGCCATTATCTTGTTAAAATGCTGTGGTTTTGGAGACTGTCGGCCCTCTCGGGGTCTTATCTGTTGACTCATTAAATCAGTAATGCTGCTCGTGGTGTTGTTTGTGTTTTTGGACCGTTTTATGATGCCTTGTGTGTATGAACAGGGTTCCAGGAAAGCTGAGGCAGTTTGTATTGGACCTGCACTCAGGAAAGT[T/A]GCACAGAGAGTTTCATCACGGCCCAGACCCCACAGACAGCACTCCAGGACAGGTCAGAGTTCAATGCAGACACATGCCACTTCATTTGTTTTGAGGCTTCTTTAGTTTTAACTGGGAACGGGCATAAAAATACTAACGTAAAGTGACTGATCATGAAAATATATGTATGGCTTTAATGCTGATAGTCTTATTGGTAGTGTGATATGTAGCAAAGTTATGGCATCCCAGGTTCGAGTGCTGACTCGCCAACCTTTCCTGATCCTGTTTCTTCCATCCATCCATCTTTTTCCCTCCAACTTTGTTTTCTGTCCAGCTACTGTCATGAATATTACAAAAATTAATACATAATTGTATGGCTCAAATGTTTGCCCCTAAGCTTTTACTAGTACACATCAAAGTGTTACATTAATTTAATTATATAATAAATGTATTTTATTTTTTTGTTATTTACTTTTATTCCCTAATTCAATATATAATCTATTTAAATCTCATGCCAACTC
Associated Phenotype:
Not determined