Busch Lab

ZMP

smarcd1

Ensembl ID:
ENSDARG00000019004
ZFIN ID:
ZDB-GENE-030131-1835
Description:
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1 [Sour
Human Orthologue:
SMARCD1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 [S
Mouse Orthologue:
Smarcd1
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 Ge

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32372 Nonsense Available for shipment Available now
sa32371 Nonsense Available for shipment Available now
sa24071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32372
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003422 Nonsense 8 510 1 13

The following transcripts of ENSDARG00000019004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 6972141)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6995469
GRCz11 22 7025315
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTCTGTTTGCGGCTCGCGGAGAAGAAGATGGCGGCGCGGAGTGGTTTT[C/T]AGCCTTCGACACCCGGTGGCGGCGGAGCCCCGATGGGACCCGGGCCGCCG
Long Flanking Sequence:
TTTATTCTTCTTCTGGAAAAAAAATCGTCACGTAACATTTTTGTCCCAGACCCTTAAAAGTGGGGTAAATCATGCAGGCTAATCTGGCATTTCTGCATAAACTCACAGTATAAAACAGCAGCATTACAAAATAAACACATACTTTAACAGTTTAAAATAAAACTTAATAGAAAAATCGGTACTTACACTTTCCTTGTCATCCGTGTCGTCCATTAGCGCATCCATGATCCAATCCGACAGGTAACGCTGTCACAAAAAACTAGGGTCCTAAAGATGCGGTCCTAAAAATGCGGTCCTGAGAGTGCAGCCACTCCAGTTGTGCAGGATTACCCTTCTCATCGTCAGCGCAAGCGCGACGTCTCTTCACACCTCGCGAGACTCTACCTCAGCTCTGAACGCCTGTGCTCTTCAATTCTCGCGATACTAGTTTCAAGTCTCACCGGTGGTTCTCTGTCTGTTTGCGGCTCGCGGAGAAGAAGATGGCGGCGCGGAGTGGTTTT[C/T]AGCCTTCGACACCCGGTGGCGGCGGAGCCCCGATGGGACCCGGGCCGCCGGTAGCCGGAGCAGGACCCGGTATGGGTCCCGGTACACCCTCAGGAAGGATGGGACCAGGCGGCCCGCAGAACCACATGTACCGATCACCGATGCCCGGTTACCCGGTAAGGCGCGAGGAGAACAAAGAAGCAGCCGCGCATAAACCGAGGGCTTTAGTTTTAAAGTCTGAACGCAGAATTTGCTCGTTTATTTAAAGCGTCAACATTGAATCCGTTTAAAATGGTTTCTATAGTGTTAAATTGAGAATATACTCTATTATTATGCTCGACTGTGGTTGCGTTGCTTACCGTTTGGTTCAATGCTAAGCGTCAAACTTTATTTCAGTAAACCAGAAATTAGATTATTTGTTTGTGTTTCACTTGAGAATGACTTGAGGAATATTAACCTGCAGTTGGTTTTGATGGTGTAAACAGAGTTTCTGCGGAAGCTCTGTGTGTAACCGCGCGGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4193
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003422 Essential Splice Site 214 510 6 13

The following transcripts of ENSDARG00000019004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 6965362)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6988690
GRCz11 22 7018536
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCAAAGAAGCTGATATGGCAATAAACTCAATTTCTTTCTCTTATCACA[G/T]ACYGCTGTGTCCAAGTATGAAGCCACCAAGCAGAAGAGGAAGTTTTCTTC
Long Flanking Sequence:
AAAATGACCATTACCTCCTTTATTTTCTCTTGTGTGGATTTAAACCTTTTATTGTTAAACACAAAAGAAGATATATTAAAGAATGCTGTTTGCTGGCACCCAATGACTTCTATAGTAGACAAATAATGCTAAGGAAGCTAAGGGTTGTCAGGCACCAACATTTTTCAAAATGTCTTGTTCTGAACGAGTAAATGATGATTAATTGTTCATTTTTGGGTGAGCTATCCCATTAGGTCAAACCCCTTATCGTTTCTGTAGAAGTACACTATTTTTATTTGTAAAACTGAATTCTTTGTCACAGACTGAAACCATAAATTGTTTTAGATTTTTATCTTGTATATTATCATTATTATTGTTGTTCATTTATTTTTATCTTGTGTATTATTTACTGCTGGTGATGACTTCTAATTGCTATAATATTTTTATAATCATATGCCAATGCCATGACATAGCCAAAGAAGCTGATATGGCAATAAACTCAATTTCTTTCTCTTATCACA[G/T]ACCGCTGTGTCCAAGTATGAAGCCACCAAGCAGAAGAGGAAGTTTTCTTCTTTTTTCAAGTCTTTAGTGATCGAGTTGGACAAAGACTTGTATGGACCTGACAATCATTTGGTTGAGGTGAGAATCAGAAATTGTGTTTCTCAAGTATAGTACTTTAAACTTAGTTTATTGCTGTGCTGTCCAGTAGATCCTCACTGCTGTCACTTATGTGCCATTTCTCACATCTTTGTCTTCATTACAGTGGCACAGAACAGCCACAACTCAGGAGACAGATGGATTTCAGGTCAAGAGGCCTGGGGATGTTGGGGTCCGCTGTACTGTACTGCTCATGCTGGACTACCAGGTAAACTTCAATTATAGTTGTGCACATGGTGTGTTTATTAGCATTTTTGTTCAAAAATCACCAGCAGATGGCGCCACCTCTTCTTGAGACATGCTTGAACTGGATATTATTTAGATTAAATGTGACTGATGGACGAAATCATTCTCTTTCTAGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32371
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003422 Nonsense 235 510 6 13

The following transcripts of ENSDARG00000019004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 6965297)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6988625
GRCz11 22 7018471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATGAAGCCACCAAGCAGAAGAGGAAGTTTTCTTCTTTTTTCAAGTCTT[T/A]AGTGATCGAGTTGGACAAAGACTTGTATGGACCTGACAATCATTTGGTTG
Long Flanking Sequence:
AGAAGATATATTAAAGAATGCTGTTTGCTGGCACCCAATGACTTCTATAGTAGACAAATAATGCTAAGGAAGCTAAGGGTTGTCAGGCACCAACATTTTTCAAAATGTCTTGTTCTGAACGAGTAAATGATGATTAATTGTTCATTTTTGGGTGAGCTATCCCATTAGGTCAAACCCCTTATCGTTTCTGTAGAAGTACACTATTTTTATTTGTAAAACTGAATTCTTTGTCACAGACTGAAACCATAAATTGTTTTAGATTTTTATCTTGTATATTATCATTATTATTGTTGTTCATTTATTTTTATCTTGTGTATTATTTACTGCTGGTGATGACTTCTAATTGCTATAATATTTTTATAATCATATGCCAATGCCATGACATAGCCAAAGAAGCTGATATGGCAATAAACTCAATTTCTTTCTCTTATCACAGACCGCTGTGTCCAAGTATGAAGCCACCAAGCAGAAGAGGAAGTTTTCTTCTTTTTTCAAGTCTT[T/A]AGTGATCGAGTTGGACAAAGACTTGTATGGACCTGACAATCATTTGGTTGAGGTGAGAATCAGAAATTGTGTTTCTCAAGTATAGTACTTTAAACTTAGTTTATTGCTGTGCTGTCCAGTAGATCCTCACTGCTGTCACTTATGTGCCATTTCTCACATCTTTGTCTTCATTACAGTGGCACAGAACAGCCACAACTCAGGAGACAGATGGATTTCAGGTCAAGAGGCCTGGGGATGTTGGGGTCCGCTGTACTGTACTGCTCATGCTGGACTACCAGGTAAACTTCAATTATAGTTGTGCACATGGTGTGTTTATTAGCATTTTTGTTCAAAAATCACCAGCAGATGGCGCCACCTCTTCTTGAGACATGCTTGAACTGGATATTATTTAGATTAAATGTGACTGATGGACGAAATCATTCTCTTTCTAGCCCCCTCAGTATAAGCTGGACCCCCGCCTGGCCCGGCTGCTGGGGATTCACACTCAGACCCGGCCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24071
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003422 Nonsense 317 510 8 13

The following transcripts of ENSDARG00000019004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 6964773)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6988101
GRCz11 22 7017947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGATTCACACTCAGACCCGGCCTGTGATCATTCAGGCTTTGTGGCAGTA[T/A]GTGAAGACCCACAAACTCCAGGACCCTCATGAACGAGAGTTCATCAACTG
Long Flanking Sequence:
TGTATGGACCTGACAATCATTTGGTTGAGGTGAGAATCAGAAATTGTGTTTCTCAAGTATAGTACTTTAAACTTAGTTTATTGCTGTGCTGTCCAGTAGATCCTCACTGCTGTCACTTATGTGCCATTTCTCACATCTTTGTCTTCATTACAGTGGCACAGAACAGCCACAACTCAGGAGACAGATGGATTTCAGGTCAAGAGGCCTGGGGATGTTGGGGTCCGCTGTACTGTACTGCTCATGCTGGACTACCAGGTAAACTTCAATTATAGTTGTGCACATGGTGTGTTTATTAGCATTTTTGTTCAAAAATCACCAGCAGATGGCGCCACCTCTTCTTGAGACATGCTTGAACTGGATATTATTTAGATTAAATGTGACTGATGGACGAAATCATTCTCTTTCTAGCCCCCTCAGTATAAGCTGGACCCCCGCCTGGCCCGGCTGCTGGGGATTCACACTCAGACCCGGCCTGTGATCATTCAGGCTTTGTGGCAGTA[T/A]GTGAAGACCCACAAACTCCAGGACCCTCATGAACGAGAGTTCATCAACTGTGACAAATACCTCCAGCAGGTAACGAATGTCATGGACTTTATTTATGGGAACTAGTGAATGAAGACTTAAACTGGAAATACCCGTTTAGACAGAAGTGGTGACGTCTGACAATTATAAACTTCTTTAGTTGATAATTAAAGACTAGTAAAAAATTTCAGTATTATCAGAAAAAAACTACTGTGAAACTAAACTTTAAAATATTTGATCCTGAACGGCTATAGTTCAACTTAATTCATTTAATAATTGGCACTTCTACTTGGTGTAGGTCTTTGAAACAAACTCCTTTTACAATTCTTCTCATTCTAGATGTTTGAAATCCATTAATTGACTTATTTTATTTTAGATCTTCGTTTTAAGTTTTAATTCTTATTATAGATCGTACAACCAATAATAGATAGTTCTAGATTTTTGACAGCGGTTGGTTCTTCTCAGTGACTACGTTTACATGG
Associated Phenotype:
Not determined