Busch Lab

ZMP

smc3

Ensembl ID:
ENSDARG00000019000
ZFIN ID:
ZDB-GENE-030131-3196
Description:
structural maintenance of chromosomes protein 3 [Source:RefSeq peptide;Acc:NP_999854]
Human Orthologue:
SMC3
Human Description:
structural maintenance of chromosomes 3 [Source:HGNC Symbol;Acc:2468]
Mouse Orthologue:
Smc3
Mouse Description:
structural maintenace of chromosomes 3 Gene [Source:MGI Symbol;Acc:MGI:1339795]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa43874 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11934 Nonsense Available for shipment Available now
sa37546 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43874
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019786 Essential Splice Site 5 1216 1 29
Genomic Location (Zv9):
Chromosome 22 (position 32596227)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29957357
GRCz11 22 29906552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTTCTGAGGAGTGTTTTGTGCATAAACCGCCATGTACATTAAACAGG[T/C]AAGATGCGACTCACGCGTTGCTTGCAACATTATAATTTACGTGGTACATT
Long Flanking Sequence:
TTTCCTCTTAAGTTTTTCTATTGAGAGCATCTGTCTTGGCGCCCAAGATGGACTGAACTATCTTTACAGAAAAAGGGGAACCGTTCAGTGACGAAATGTATATAAAACTAACGTAAAGCAAAGAGTTGATTAAAAATTCGGCTAAAGCACATATATTTACATTTTCTTGATAACGTAAAGTACGTGCGATCCATCTGCTACCGTTTTGAACATCTATTTTAAACAATAACGTCAAGGCTCCCCTAAAAGATCAAGTAGACTGACCCGCTCGTCCCGCCTCTGTCGCCATTTTGACTGTTATGTCTTTTGCGTGAGGGGAGGGAAAATAAAATTTGATACTACAGAAGAGTCAAAATTCAACAATTTTATCCGGTGTGCAGGATTTTTTTGTTATCACTAAAGCCCTTCTTCTCTTTGAGGAGGAGGGTGTTTAATTCAGCTTTATTTAATTGGTTTCTGAGGAGTGTTTTGTGCATAAACCGCCATGTACATTAAACAGG[T/C]AAGATGCGACTCACGCGTTGCTTGCAACATTATAATTTACGTGGTACATTGTGCAACTTAACAACTTTATTTTCCATCTTAAAGGTGTAAATGAGTTTTTGTTTATTTTAAGCATGCTCGGTTGTAAGTTTTTGCGAGTATATGGCCTGAAGTTAGCATTAGCTTTAGCATTAGCTGTCAAATCCCACTAAGCATAACAGTACCATCTATTATTCCGAATCCTTTTTTAAGTAGTCAAAAATCACTTATTATTATTATTGTTAATATTGGCTCCAGCCGTTGTTCAGTTGTGAGCAAACTAATACCTTAACGTTAGTTAAAAATAATAATTCTATGTAACGTCAGTCACTAATGCTAGTTATAAATTAACGTTATGTGAGTCACAAAAATAGTGTTAGTTACATGTCTTTGTTTATAAAGTCACGTTTTGCTTTCATAATATTTTGATTCTAGGCTTTTTGGCAGGTTATATTGTTAAATACATGGTTATATACTAGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29821
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019786 Essential Splice Site 44 1216 3 29
Genomic Location (Zv9):
Chromosome 22 (position 32595367)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29956497
GRCz11 22 29905692
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTTTCAGTCGGCAGAAATGGATCAGGAAAGAGTAACTTCTTTTATGG[T/C]ATGTAAAGAGTATTTATTTAAATTTTTGTTTTAGATCTAAGTAATATAAA
Long Flanking Sequence:
TATAAATTAACGTTATGTGAGTCACAAAAATAGTGTTAGTTACATGTCTTTGTTTATAAAGTCACGTTTTGCTTTCATAATATTTTGATTCTAGGCTTTTTGGCAGGTTATATTGTTAAATACATGGTTATATACTAGTTTTGTCAGTTACAAGTTGTTTGTGAAAGCATATTTTGATTTAAAGCATTGTGACTGGTTATGTTTTCATTATTACACTGAATTGATGTTATCTATATGAATGGATTGTGAAATCTGTTTTTCAGGTCATTATTCAAGGCTTTCGAAGCTACAGAGATCAAACTGTGGTCGATCCCTTCAGCTCAAAACACAATGTCATCGGTAAAACTCTTCCACATTTTAAATAAGACAAGTATTTACAGCAGTTCTGCAAATACTCAATCAGTATTGTATTTTATTCCCCTCTTTAATTGTCTAATTTAAAATGTTATCTATTTTTCAGTCGGCAGAAATGGATCAGGAAAGAGTAACTTCTTTTATGG[T/C]ATGTAAAGAGTATTTATTTAAATTTTTGTTTTAGATCTAAGTAATATAAATAGATGCAAATACAGATTTTGCCGATGTATAGTCTGTAATAAGCATTTTCATCGCTCCTCAGCTATACAGTTTGTACTCAGCGATGAGTTCAGTCATCTTCGGCCAGAGCAGCGTTTGGCTCTGCTTCATGTGAGTAATGTTACACCCATTTGTTTTTCTTCGTTATTTTTTTTAAACGCATATCTGTTGTAGCACATAAGTCCTGACAAAATTGAAATGGAGAATTCTTATTTTGCATTATTGCACTATACATTATAAATAATTCAATTGAGGTAAAATTGGTTTTATATTCACACATTCAGATTTTCTAACTGATGGTATAATTTCAGAAAAGTATTCTTTGCGAATTCTAAATAGCTAAATCACATTAGCAGCCAAGGACTATCAAAGTGCAACACTGTTCAAAACAACATTAGCACTATTTAATTGACTCTGAAGTCATACTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11934
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019786 Nonsense 280 1216 11 29
Genomic Location (Zv9):
Chromosome 22 (position 32581183)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29942313
GRCz11 22 29891508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TNNNNNNNNCTCTGTAGGAGACGGAGCRTGTGGTGCGGGAGCTGAAGTCT[C/T]GAATCTCCGCCATGAAGGAGGAGAAGGAACAGCTGAGCGCMGAGCGACAG
Long Flanking Sequence:
ACAAACTGATCACCTCAGATACCCCTCATGTGCTTTCTTTAGGGTTGAATGCTAATAATGTGAGTTTGAATGCTATTTTACATGAAAATTATTGCTATACATGCAAAAGATGTGATTAATATGTTTTGGTGGCAAACACATCATGCATTCTGTGTTATTTGTTTTACATTTGATGAGAACCCAGCATTAATATACTGTTGTGTAAGAAATACATTAAACAAAATCTTTTATTATTTTTAATATTATTATTATATCAATATACAGCAATTAATTAATTATACATTATATTATATACGCTTCTCTGCAAAAAGTTGCAAACACCATGATGGGAAAATAAGAAAGTACTTGATTTGAATACCTGAAATTCTGGTAATAACGTTAGATTTTCACTTAAGCAGCCTCTGAAACTGCTTTCATCAGCTTATTGAGTAATGTTATCTAACCTCTGTGTTTCTGTGTCTCTGTAGGAGACGGAGCGTGTGGTGCGGGAGCTGAAGTCT[C/T]GAATCTCCGCCATGAAGGAGGAGAAGGAACAGCTGAGCGCAGAGCGACAGGAGCAGATCAAACAGAGGACCAAACTGGAGCTCAAAGCCAAAGATCTGCAGGACGAGCTGGCAGGAAACAGCGAACAGAGGGTGCGACTAGCAGACGCACACACACTAACACATGCACGCGCTACAGGCACACATATGCACTCAACGCACACATTTACAAATAGTGTTATCTTGGAAATTAGAAAGTTTCTGTTTATAAAGAAATTACTCTAATTAAATCTATATATATATATATATTAACGATTCATTAGCGGCTCGCTCATATGTCAGCCTATAGACAAACCAGCTGATCGATGTGACTTTTAAACGCTCCAGTGTTGATGTATCTATGTTTAAACTCAGTAAACAGCGAGAAGTTCGGTAAACTGATGACCTTCACAGCCAATCACAGTAATTTCTGTCAAGCATGTGAACACAATGGCAAAGAGCGCTGTTTAAGAACACGCTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29820
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019786 Nonsense 487 1216 15 29
Genomic Location (Zv9):
Chromosome 22 (position 32576259)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29937389
GRCz11 22 29886584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTACCTGTGGAGAGAGGAGAACGCAGAACAGCAGGCGCTGGCAGCCAAA[C/T]GAGAAGACCTGGAGAAGAAACAACAGCTACTGCGAGCCGCTACCGGAAAG
Long Flanking Sequence:
AGAGAGAAACCTGGAACAGTACAACGTAAGATTCACTATACAGTTTTGCTGTGAACATTTATTCTTGAACATCTTTCATTCGTAGCATTTCATCTCGGCTTCGCTTTTCGCCCACAGAAACTGGACCAGGATCTGAACGAAGTGAAGACTCGAGTGGAAGAGCTGGACAAGAAGTACTACGAGGTGAAGAACCGAAAGGATGAGCTTCAGAGCGAGAGAAAGTAAGATCCTTTTCCAAAACTCTTCCATGGCTTTGGTCCATGCTTCCAGCATTCTTTCTTATTTCCCATACCAGCCGTTCCTCTCCTCACCTGCTCTTTTAGTTATTAATATTCCACAAGCCATAGGTTTCTCAGCACGATGAGGCTATAGAATAGGGTGTCCTGCTGAAGCCAGGCGTAGTGTTTTTGAGCCAGAGCTGAAGGGTGTGTCTGTGTCCCTCCTCCTGCAGTTACCTGTGGAGAGAGGAGAACGCAGAACAGCAGGCGCTGGCAGCCAAA[C/T]GAGAAGACCTGGAGAAGAAACAACAGCTACTGCGAGCCGCTACCGGAAAGGTAAGAAACCTAACAACTGAACGTTTAAGATGTATTTATCAGATTTTTATTACCTTTAAAAAAAAAAAGAAAAAGAAAATAATTGTATATAACGTATATAATGAATAATATAACGTATATTCCATACATAAAAGTAACATAACAGTCAGTCGGACGGACGGTCACTCTACAGCGGCCTCCGGCGGCTATTTACGCGAGAACAGTGCGGGCGCAAACAGGCCTCTCGCGGATTTGCGAAAACAAAAACTGCTTGAATACGTACCTCCCGGGACGTATTTCGCGGTCTCCAGAAACATCTGCGGGGCTACGTTTCCACAATGAGCCCGGGTTGATATTTTTTTTACTTTGATATAGGGGCTGTATGGTATTGGAAAAATCTGACATTGATATGCCGAGATATAAATTGTGATATAAATGTAATTTCAGCAGATGATTTGAATACCTCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37546
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019786 Nonsense 1151 1216 27 29
Genomic Location (Zv9):
Chromosome 22 (position 32550723)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29911853
GRCz11 22 29861048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCTGCTCCATTCTACCTGTTTGATGAAATCGACCAGGCTCTGGACGCT[C/T]AGCATAGAAAAGCAGTGTCAGGTAATCACTAGTGATTGTTGATAACAGTG
Long Flanking Sequence:
AAACCATTTATAAGCATACTACTGTTTACAAACTACAGCAGCACAGCCACTATTTTGGAGCCATAGTATCGCGATATTACTATAGTACTGGTAAACCGTGCAACCCTACCGTACAGGTAAAAAATTCACTTCTGTGAGCAGATGTCTGACCTCATCTGACTGATACCATACATTTTGGACAATTAATTTACTGTAGAATAATAATAATAAACATCCTCTGATCAGCAAAGCATATCTGTATCATTTTCATATATTTTAAGACATTGTTGCCTGGTTTATTGTGCGTCTCTTGTTTGTGTGCGGTTTTATATGCACAGTCTTAACGACTTGTTTGTGTTGGTCAGGTGTCATTCACGGGTAAACAGGGAGAGATGAGGGAGATGCAGCAGCTTTCTGGAGGTCAGAAGTCTCTGGTGGCTTTGGCTCTCATCTTTGCCATCCAGAAGTGCGATCCTGCTCCATTCTACCTGTTTGATGAAATCGACCAGGCTCTGGACGCT[C/T]AGCATAGAAAAGCAGTGTCAGGTAATCACTAGTGATTGTTGATAACAGTGATGCACTGCACATTATTGCAAATGAAGAAGTCCGTAAACAGTTAACATCTAAAATGATCCAACTTTATCTAAAACTATTTGTTTGTAGTCTGCAGCAAATCTCCACCAGAAATATGTTATTATTTATTTAGATTTTATGATTAGGGGTAATGGGCATCTTGGTTTTATTCAGGGTGTCTGCAGGGTCTTAAAAATTCCTAATGGCCTAAATTTCAAAAACACGAATTTTCAGTCTTAAATTCACTGAAATATTGTATTGTTGGATTAAAATTTCCCTATGTCTAAGTAAAGATATCCTATATGGCTGACCTTCAATTAACAATAATCTTTCTCAAAACTTATTTTTATATTTAAGTTTTTATTGTAAAGAAACAATTCACAACAGCTGTTAGACATTTTACAGCAAATTCTCTAACTATCAGACATGGAAAACTAAAGCAACACGTCTTT
Associated Phenotype:
Not determined