Busch Lab

ZMP

sptlc2

Ensembl ID:
ENSDARG00000018976
ZFIN ID:
ZDB-GENE-050522-23
Description:
serine palmitoyltransferase 2 [Source:RefSeq peptide;Acc:NP_001018455]
Human Orthologue:
SPTLC2
Human Description:
serine palmitoyltransferase, long chain base subunit 2 [Source:HGNC Symbol;Acc:11278]
Mouse Orthologue:
Sptlc2
Mouse Description:
serine palmitoyltransferase, long chain base subunit 2 Gene [Source:MGI Symbol;Acc:MGI:108074]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23036 Nonsense Available for shipment Available now
sa17532 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23036
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123350 Nonsense 111 558 3 12
Genomic Location (Zv9):
Chromosome 17 (position 17641810)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17791821
GRCz11 17 17811657
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAATGTGTTCCTGTTTCTTTTTGTTTCTGAAGGACTTTGTTCCACTTTA[T/A]CAAGACTTTGAGAATTTCTACACCAGGAATTTATACATGAGGATTCGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17532
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123350 Essential Splice Site 207 558 4 12
Genomic Location (Zv9):
Chromosome 17 (position 17642385)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17792396
GRCz11 17 17812232
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGACTGTGAAATTTGGGGTGGGCGTGGCCAGCACCAGGCAGGAAATGGG[T/A]AAGTGCTCATTGGTTARTMATGCTTTTTAAGATAATTCGCCACAATGCAC
Associated Phenotype:
Not determined