Busch Lab

ZMP

acvr1b

Ensembl ID:
ENSDARG00000018968
ZFIN ID:
ZDB-GENE-980526-527
Description:
activin receptor type-1B [Source:RefSeq peptide;Acc:NP_571065]
Human Orthologue:
ACVR1B
Human Description:
activin A receptor, type IB [Source:HGNC Symbol;Acc:172]
Mouse Orthologue:
Acvr1b
Mouse Description:
activin A receptor, type 1B Gene [Source:MGI Symbol;Acc:MGI:1338944]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
hu3520 Nonsense Confirmed mutation in F2 line Not yet available
sa12061 Nonsense Available for shipment Available now
sa12247 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3520
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023094 Nonsense 179 505 3 9

The following transcripts of ENSDARG00000018968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 28048191)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27881013
GRCz11 23 27807554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGAGGATCCATCCTGTGATCACCTGTACTTGGCCAAAGACAAGACCT[T/A]ACAGGATCTCATCTTCGATCTGTCCACCTCTGGTTCAGGGTCTGGTAAGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12061
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023094 Nonsense 308 505 5 9
ENSDART00000023094 Nonsense 308 505 5 9

The following transcripts of ENSDARG00000018968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 28046301)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27879123
GRCz11 23 27805664
KASP Assay ID:
554-4621.1 (used for ordering genotyping assays)
KASP Sequence:
TGACTATCTCAACCACTACTCCGTCACAATCGAGGGGATGATCAAGTTAT[C/T]GCTTTCAGCCGCCAGCGGTCTGGCACATCTGCACATGGAGATCCTGGGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6741
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023094 Nonsense 308 505 5 9
ENSDART00000023094 Nonsense 308 505 5 9

The following transcripts of ENSDARG00000018968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 28046301)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27879123
GRCz11 23 27805664
KASP Assay ID:
554-4621.1 (used for ordering genotyping assays)
KASP Sequence:
TGACTATCTCAACCACTACTCCGTCACAATCGAGGGGATGATCAAGTTAT[C/A]GCTTTCAGCCGCCAGCGGTCTGGCACATCTGCACATGGAGATCCTGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12247
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023094 Nonsense 415 505 7 9

The following transcripts of ENSDARG00000018968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 28045795)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27878617
GRCz11 23 27805158
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAAGTGTGCTGATAWCTATGCTTTGGGACTGGTATATTGGGAGATTRCA[C/T]GACGGTGTAATGCTGGAGGTGAGGAAAAATGAGACCCATCTTACACCCAC
Associated Phenotype:
Not determined