Busch Lab

ZMP

gabbr1a

Ensembl ID:
ENSDARG00000018967
ZFIN ID:
ZDB-GENE-030904-5
Description:
Gamma-aminobutyric acid (GABA) B receptor, 1 [Source:UniProtKB/TrEMBL;Acc:A8E7P8]
Human Orthologue:
GABBR1
Human Description:
gamma-aminobutyric acid (GABA) B receptor, 1 [Source:HGNC Symbol;Acc:4070]
Mouse Orthologue:
Gabbr1
Mouse Description:
gamma-aminobutyric acid (GABA) B receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1860139]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8430 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4619
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009892 Nonsense 57 966 2 23
Genomic Location (Zv9):
Chromosome 15 (position 34129648)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34975424
GRCz11 15 34833393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTTTCTCTGTCTGTAGATCCGCWGTGTGCAGATCTTACCGGTAGACTA[T/A]GAGATTGAATATATCTGTAGAGGAAGCCGAATTATTGTGGGACCCAAAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3922
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009892 Essential Splice Site 156 966 3 23
Genomic Location (Zv9):
Chromosome 15 (position 34126132)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34971908
GRCz11 15 34829877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTACCAAACTGGGCAAATGGGACTCACCAAAACCCCTRTGTGTCTGTGA[G/A]TATGTTTAACTATCWGTCAGACCAACCAAAATATGTGCAGTTCTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8430
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009892 Nonsense 869 966 21 23
Genomic Location (Zv9):
Chromosome 15 (position 34016137)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34861913
GRCz11 15 34719882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGATTTTAGTGTTTTTTCCCCTTCAGAWCCGCCGTTTKATCACTCGCGGC[G/T]AGTGGCAGTCGGAGCAGCAGGACACACTGAAGACCGGCTCATCCACCAAC
Associated Phenotype:
Not determined