Busch Lab

ZMP

gtpbp4

Ensembl ID:
ENSDARG00000018961
ZFIN ID:
ZDB-GENE-030131-5982
Description:
nucleolar GTP-binding protein 1 [Source:RefSeq peptide;Acc:NP_956145]
Human Orthologue:
GTPBP4
Human Description:
GTP binding protein 4 [Source:HGNC Symbol;Acc:21535]
Mouse Orthologue:
Gtpbp4
Mouse Description:
GTP binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916487]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32998 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32998
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026339 Essential Splice Site 154 631 None 16

The following transcripts of ENSDARG00000018961 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42474693)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42524157
GRCz11 2 42373575
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACCATCTTAAAGCGACAGAAACAGAGCCTGGAGTATTTAGAGCAAGG[T/C]ATGAACAGTTAAATGCTCACATATTTTCCAGCATTTTATACATTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25882
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026339 Nonsense 239 631 7 16

The following transcripts of ENSDARG00000018961 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42472120)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42521584
GRCz11 2 42371002
KASP Assay ID:
2259-2488.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCTGGTATTCTGGATCATCCTCTTGAGGAAAGGAACACCATAGAAATG[C/T]AGGCCATCACGGCTCTGGCTCATCTGCGTGCTGCTGTCCTCTATGTCATG
Associated Phenotype:
Not determined