Busch Lab

ZMP

tmem39b

Ensembl ID:
ENSDARG00000018956
ZFIN ID:
ZDB-GENE-030131-6042
Description:
Transmembrane protein 39B [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW11]
Human Orthologue:
TMEM39B
Human Description:
transmembrane protein 39B [Source:HGNC Symbol;Acc:25510]
Mouse Orthologue:
Tmem39b
Mouse Description:
transmembrane protein 39b Gene [Source:MGI Symbol;Acc:MGI:2682939]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa6317 Nonsense Mutation detected in F1 DNA Not yet available
sa38955 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6317
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002095 Nonsense 176 491 5 9
Genomic Location (Zv9):
Chromosome 13 (position 33496713)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33142661
GRCz11 13 33273111
KASP Assay ID:
554-4506.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGTGACGGCTCGTTTTGCMGTGCTGACTCTTGCAGGATGGAGTYTGTG[T/A]CGTTCACTTATTTAWCTCTTCAAGACGTATTCTGTGCTCAGCCTGCTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2722
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002095 Nonsense 181 491 5 9
Genomic Location (Zv9):
Chromosome 13 (position 33496728)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33142676
GRCz11 13 33273126
KASP Assay ID:
2260-6677.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGCMGTGCTGACTCTTGCAGGATGGAGTYTGTGTCGTTCACTTATTTA[T/A]CTCTTCAAGACGTATTCTGTGCTCAGCCTGCTCTTCCTCTGCTATCCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38955
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002095 Nonsense 215 491 6 9
Genomic Location (Zv9):
Chromosome 13 (position 33499630)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33145578
GRCz11 13 33276028
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGAATGTACATCCCGTTCTTCCGCCTCAGCTGTGATTTCCGCAGAGCT[G/T]GATCTATGTCTCCATTAAGTGGCATTGGTTCTAAAGATGTGGGTGCGGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7730
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002095 Nonsense 479 491 9 9
Genomic Location (Zv9):
Chromosome 13 (position 33504737)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33150685
GRCz11 13 33281135
KASP Assay ID:
2260-6678.1 (used for ordering genotyping assays)
KASP Sequence:
TATGCCTTTTTCAAGCTGCTCAGAGACAGAATAGTTTTGGGGAAAGCGTA[T/A]TCKTATTCAGCCAGTGCCTCTAATCAGAAAGTCAGTTAGAAAGGGATAAA
Associated Phenotype:
Not determined