Busch Lab

ZMP

fat2

Ensembl ID:
ENSDARG00000018923
Human Orthologue:
FAT2
Human Description:
FAT tumor suppressor homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:3596]
Mouse Orthologue:
Fat2
Mouse Description:
FAT tumor suppressor homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2685369]

Alleles

There are 16 alleles of this gene:

Allele Name Consequence Status Availability
sa24958 Nonsense Mutation detected in F1 DNA Not yet available
sa22485 Nonsense Available for shipment Available now
sa22484 Nonsense Available for shipment Available now
sa22483 Nonsense Available for shipment Available now
sa35694 Nonsense Mutation detected in F1 DNA Not yet available
sa16670 Nonsense Available for shipment Available now
sa8497 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39000 Nonsense Mutation detected in F1 DNA Not yet available
sa38999 Nonsense Mutation detected in F1 DNA Not yet available
sa13608 Nonsense Available for shipment Available now
sa31986 Essential Splice Site Available for shipment Available now
sa42395 Nonsense Mutation detected in F1 DNA Not yet available
sa22482 Nonsense Available for shipment Available now
sa19084 Nonsense Mutation detected in F1 DNA Not yet available
sa15091 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24958
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 259 4342 1 23
Genomic Location (Zv9):
Chromosome 14 (position 27180828)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25874030
GRCz11 14 26171275
KASP Assay ID:
554-7345.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGGTTGTTGTGAAGATCCAAAAAGTAGAAAAGAATTTCACCCTTATTT[C/A]ACCAACCACTGCAGAGAGTCTGCTAACGATCGATGACAAAATAAGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22485
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 323 4342 1 23
Genomic Location (Zv9):
Chromosome 14 (position 27180635)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25873837
GRCz11 14 26171082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTTTTATGATGGTGGCTTTCAGCTGGTCTCAACAAAATTTATTGACTG[G/A]TCACAGAACCCATTAGGACTAAACATTTCTCTTCAGGCCAAAGACAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22484
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 757 4342 1 23
Genomic Location (Zv9):
Chromosome 14 (position 27179335)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25872537
GRCz11 14 26169782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGATAATGACTCTGGATTTAACGGAAAGCTTGTCTATTCAATTTCAAGT[G/T]GAAATGAGGACGGATGCTTTACTATCGATGTGAACGCAGGGGATCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22483
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 948 4342 1 23
Genomic Location (Zv9):
Chromosome 14 (position 27178762)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25871964
GRCz11 14 26169209
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATCAAAGTTCCTGAGGATGTTCCTCCAGGCACAGTGCTGCTATGGGTT[G/T]AAAGTTTTGATTTAGATCTGGAGAGCGGCGGTGTCATAAGCTACAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35694
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 952 4342 1 23
Genomic Location (Zv9):
Chromosome 14 (position 27178749)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25871951
GRCz11 14 26169196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGGATGTTCCTCCAGGCACAGTGCTGCTATGGGTTGAAAGTTTTGATT[T/A]AGATCTGGAGAGCGGCGGTGTCATAAGCTACAACCTGAAAAACAGCGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16670
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 1019 4342 1 23
Genomic Location (Zv9):
Chromosome 14 (position 27178549)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25871751
GRCz11 14 26168996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGACCATGGAAAGCCCCGKTCTTTRTCATCTTCGTGTTTTATTGAGATT[G/T]AAGTATTAGATGTCAATGAAAACCWGAACCGGCCTCTCTTTGGTGAAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4562
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 1166 4342 2 23
Genomic Location (Zv9):
Chromosome 14 (position 27177670)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25870872
GRCz11 14 26168117
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTGCCAAAAGATAAATCTGTGCTGAAAGTTTCWGCCACAGACATGGAC[A/T]AGTCCTCWGAAGGGAAGCTTGCTTTCCAGATCCTTGATTCTCAGCGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8497
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Essential Splice Site 1523 4342 7 23
Genomic Location (Zv9):
Chromosome 14 (position 27166884)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25860086
GRCz11 14 26157331
KASP Assay ID:
2260-7578.1 (used for ordering genotyping assays)
KASP Sequence:
AAGAGGAGCTTGACTACGAGACCAKCTCCACTCATACTCTGATTGTGATG[G/A]TAAAGTGACACTTGACTTGACTSARCTGGACTCTCATCTCAAGGTCTTAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39000
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 1557 4342 8 23
Genomic Location (Zv9):
Chromosome 14 (position 27166440)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25859642
GRCz11 14 26156887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGTGGAGGACTGCAATGACCACATCCCATCGTTTCTGGATACTCATTA[T/A]GAGGGCATCATAAGTAATCTAGCACTTACAGGCACTGAAGTGCTAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38999
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 1726 4342 9 23
Genomic Location (Zv9):
Chromosome 14 (position 27165704)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25858906
GRCz11 14 26156151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGTCAGTCAAAAATGCACTCGATTTTGAGCAGCACAGCAGCTACCATT[T/A]GCAAATAAGTGCTACAAATACGGCAGGAATCTCATCTGATGCTGTAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13608
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 2338 4342 9 23
Genomic Location (Zv9):
Chromosome 14 (position 27163869)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25857071
GRCz11 14 26154316
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTAAGTGGAGTTTTGRTGACTACACAAGTATTGGACTAYGAARGTACA[C/T]AGCAGTYTACTTTAAAAGTGAAAGCCACAGATAAAGGGGTACCACCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31986
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Essential Splice Site 3006 4342 10 23
Genomic Location (Zv9):
Chromosome 14 (position 27160475)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25853677
GRCz11 14 26150922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGGTCCATGTTCTTGACCTCAATGACAACAGTCCTTTCTGTGAGCAA[G/T]TAAGTATGCACTTATTCACTTATTCACTAGGGGCCTCTGCACAGAAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42395
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 3129 4342 12 23
Genomic Location (Zv9):
Chromosome 14 (position 27159267)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25852469
GRCz11 14 26149714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCACAGTGTTTGACAACACAACCATTAGGACGCCTATTGCTGTCATCTA[T/A]GCCAAAGACCCAGACACAGGTATGGCAATGTTTCTCTTCACGAATGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22482
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 3529 4342 18 23
Genomic Location (Zv9):
Chromosome 14 (position 27137624)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25830826
GRCz11 14 26128071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATCAACATCACAGAGCAGAGCCGGTATCCACCTACTGTGAATCCGCTT[G/T]AGATTTTCATCACCACTGCTGGTGGTCCAATCTTGAAGAGTGTCATCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19084
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 4190 4342 23 23
Genomic Location (Zv9):
Chromosome 14 (position 27116469)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25809671
GRCz11 14 26106916
KASP Assay ID:
2260-7574.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTACTTAAAAAGAACTAATCATTTTTCAACTTTTCTCATTCACAGTGTA[T/A]CCAGCTGACCCTGACTACTATGGTCGACCCGCCGTTCAGGAGTTCCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15091
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 4285 4342 23 23
Genomic Location (Zv9):
Chromosome 14 (position 27116186)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25809388
GRCz11 14 26106633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGCCCTAATGAGTACACTGCCATAAGCTACTACCCTACCCAGCACGCT[C/T]GAAGCCTGGACAACGTCTCCAGCGGCTATAAGAGACTCAGTGTGCGTCTG
Associated Phenotype:
Not determined