Busch Lab

ZMP

fam84a

Ensembl ID:
ENSDARG00000018921
ZFIN ID:
ZDB-GENE-040426-1247
Description:
family with sequence similarity 84, member A [Source:RefSeq peptide;Acc:NP_956912]
Human Orthologue:
FAM84A
Human Description:
family with sequence similarity 84, member A [Source:HGNC Symbol;Acc:20743]
Mouse Orthologue:
Fam84a
Mouse Description:
family with sequence similarity 84, member A Gene [Source:MGI Symbol;Acc:MGI:2145011]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37079 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37079
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023006 Nonsense 72 260 2 2
Genomic Location (Zv9):
Chromosome 20 (position 32796274)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32854514
GRCz11 20 32757393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAACAGCCCGAGCAAAGACGGTCCGGTTGCGCGCAACGAAATCGAGTA[C/A]ACGGCTTTCTGCTGCCAGGAATGTATTTACTCCAAACTGCGAGAAAACGA
Associated Phenotype:
Not determined