Busch Lab

ZMP

rnaseh2a

Ensembl ID:
ENSDARG00000018891
ZFIN ID:
ZDB-GENE-040426-976
Description:
ribonuclease H2 subunit A [Source:RefSeq peptide;Acc:NP_956520]
Human Orthologue:
RNASEH2A
Human Description:
ribonuclease H2, subunit A [Source:HGNC Symbol;Acc:18518]
Mouse Orthologue:
Rnaseh2a
Mouse Description:
ribonuclease H2, large subunit Gene [Source:MGI Symbol;Acc:MGI:1916974]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa375 Essential Splice Site Available for shipment Available now
sa11134 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa375
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045894 Essential Splice Site 109 307 4 9
Genomic Location (Zv9):
Chromosome 1 (position 52212195)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51083879
GRCz11 1 51718243
KASP Assay ID:
554-0355.1 (used for ordering genotyping assays)
KASP Sequence:
GCCCTTCAGATCCTCTCGCCCAACATGATTTCCACCAGCATGCTACAAAG[G/T]TACCAGCATGCTAGATTTCAGTGAAGAGAAGGCTAGTGTGATGTTATGTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11134
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045894 Essential Splice Site 109 307 5 9
ENSDART00000045894 Essential Splice Site 109 307 5 9
Genomic Location (Zv9):
Chromosome 1 (position 52210499)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51082183
GRCz11 1 51716547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ANTAGCTGCRAGTATAWCTGACATCAAGGTTTTNNNGTTGTTATTATTTTTTC[A/C]GAGCAAAATACAATCTGAATGCCCYTTCACACGATGCAGCGATTGGCCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7917
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045894 Essential Splice Site 109 307 5 9
ENSDART00000045894 Essential Splice Site 109 307 5 9
Genomic Location (Zv9):
Chromosome 1 (position 52210499)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51082183
GRCz11 1 51716547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ANTAGCTGCRAGTATAWCTGACATCAAGGTTTTNNNGTTGTTATTATTTTTTC[A/T]GAGCAAAATACAATCTGAATGCCCTTTCACACGATGCAGCGATTGGCCTG
Associated Phenotype:
Not determined