Busch Lab

ZMP

snrpa

Ensembl ID:
ENSDARG00000018890
ZFIN ID:
ZDB-GENE-030131-2841
Description:
U1 small nuclear ribonucleoprotein A [Source:RefSeq peptide;Acc:NP_955965]
Human Orthologue:
SNRPA
Human Description:
small nuclear ribonucleoprotein polypeptide A [Source:HGNC Symbol;Acc:11151]
Mouse Orthologues:
Gm5145, Snrpa
Mouse Descriptions:
predicted pseudogene 5145 Pseudogene [Source:MGI Symbol;Acc:MGI:3645482]
small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:1855690]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa23336 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23336
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012018 Essential Splice Site None 281 None 7
ENSDART00000137663 None None 199 None 4
ENSDART00000141703 Essential Splice Site None 199 None 5
Genomic Location (Zv9):
Chromosome 18 (position 33751968)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35432810
GRCz11 18 35407656
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGATTTTCAGTCGAATGTTAAAGCTGGTTGGAGCTTCTAAAATAATTG[T/A]GAGTAAATCTATATATTATTGCATGCGTTTTTATTATGTTAAATTAATGC
Associated Phenotype:
Not determined