Busch Lab

ZMP

jak2b

Ensembl ID:
ENSDARG00000018882
ZFIN IDs:
ZDB-GENE-980526-123, ZDB-GENE-980526-123
Description:
tyrosine-protein kinase JAK2 [Source:RefSeq peptide;Acc:NP_571162]
Human Orthologue:
JAK2
Human Description:
Janus kinase 2 [Source:HGNC Symbol;Acc:6192]
Mouse Orthologue:
Jak2
Mouse Description:
Janus kinase 2 Gene [Source:MGI Symbol;Acc:MGI:96629]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa33755 Nonsense Mutation detected in F1 DNA Not yet available
sa20578 Essential Splice Site Available for shipment Available now
sa31485 Nonsense Available for shipment Available now
sa31486 Nonsense Available for shipment Available now
sa17139 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33755
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Nonsense 146 1112 6 25
ENSDART00000122405 Nonsense 160 1126 5 24
Genomic Location (Zv9):
Chromosome 5 (position 69069266)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65403337
GRCz11 5 66082452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGTGCTTGCAGTGGAGGAGTGACTTTGTCAATGGCTGGGTGAAGT[T/A]GTCGGGAAGCCACGAGAATCAGGAGGAGTGCCTTGGCATGGCTGTGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20578
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Essential Splice Site 561 1112 13 25
ENSDART00000122405 Essential Splice Site 575 1126 12 24
Genomic Location (Zv9):
Chromosome 5 (position 69080985)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65415042
GRCz11 5 66094157
KASP Assay ID:
2259-6815.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGTCATTGTCAAAGTCTTGGACAAAGCACACAGAAATTATTCTGAGG[T/C]AAGAAATTTATGAAATGTATTTTTTGGGGGGTGAAAATGTAACGTGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31485
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Nonsense 606 1112 15 25
ENSDART00000122405 Nonsense 620 1126 14 24
Genomic Location (Zv9):
Chromosome 5 (position 69082891)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65416948
GRCz11 5 66096063
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGACATCATGGTGCAGGAATATGTCAAGTTTGGCTCCTTGGACACATA[T/A]CTGAAGAAAAACAAGAGCTCGGTATCAGTCAATATCCTGTGGAAGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31486
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Nonsense 805 1112 19 25
ENSDART00000122405 Nonsense 819 1126 18 24
Genomic Location (Zv9):
Chromosome 5 (position 69087292)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65421349
GRCz11 5 66100464
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGAGCGACATCATGCCCAGCAGAGCAGCAGCGTCTATATTCAACACT[G/T]GAACATTTAAGAATAATGAACCCGTGCAGTTTGAGGAGAGACATCTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17139
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Nonsense 884 1112 20 25
ENSDART00000122405 Nonsense 898 1126 19 24
Genomic Location (Zv9):
Chromosome 5 (position 69090037)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65424086
GRCz11 5 66103201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGGAAATCGAGATCCTTAAATCCCTCCAGCATGAGAACAYTGTGAAATA[T/G]AAAGGCGTGTGCTACGGTGCAGGTAYTTGTCTTTTTACSTCTTTTCACNNNNNN
Associated Phenotype:
Not determined