Busch Lab

ZMP

dclk1

Ensembl ID:
ENSDARG00000018856
ZFIN ID:
ZDB-GENE-061013-124
Description:
serine/threonine-protein kinase DCLK1 [Source:RefSeq peptide;Acc:NP_001071017]
Human Orthologue:
DCLK1
Human Description:
doublecortin-like kinase 1 [Source:HGNC Symbol;Acc:2700]
Mouse Orthologue:
Dclk1
Mouse Description:
doublecortin-like kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1330861]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21776
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086440 None None 472 None 12
ENSDART00000123957 Nonsense 285 733 4 17
ENSDART00000138755 None None 234 None 3
ENSDART00000145450 None None 496 None 12

The following transcripts of ENSDARG00000018856 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 35837282)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34869427
GRCz11 10 34813287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAGAGTGTCGAGTGGTGAAATCAACATCCTATGGGAAGGTGGGCTCTT[T/A]AAACCGAAACTCGCCTAGAAGCGTTGTCCTTTGCAGACGCAGCAAGTCCC
Associated Phenotype:
Not determined