Busch Lab

ZMP

si:dkey-199f5.8

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa14890 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14890
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007442 Essential Splice Site 336 390 5 6
ENSDART00000147210 Essential Splice Site 336 390 6 7
Genomic Location (Zv9):
Chromosome 16 (position 44515614)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41796122
GRCz11 16 41746154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGATCAAACACAAGCACGACAAAGGCAATGAAGWGAATCCCAAAAGG[T/G]AGAATTGCAGTACAAACACTGGTCAATGTTTATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTTGTCCTTGTT
Associated Phenotype:
Not determined