Busch Lab

ZMP

bdnf

Ensembl ID:
ENSDARG00000018817
ZFIN ID:
ZDB-GENE-000412-1
Description:
brain-derived neurotrophic factor [Source:RefSeq peptide;Acc:NP_571670]
Human Orthologue:
BDNF
Human Description:
brain-derived neurotrophic factor [Source:HGNC Symbol;Acc:1033]
Mouse Orthologue:
Bdnf
Mouse Description:
brain derived neurotrophic factor Gene [Source:MGI Symbol;Acc:MGI:88145]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34104 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5765
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014843 Nonsense 34 270 2 2
ENSDART00000075389 Nonsense 42 239 2 2
ENSDART00000131009 Nonsense 34 270 2 2
ENSDART00000132353 Nonsense 62 185 2 2
ENSDART00000144682 Nonsense 34 143 3 3
ENSDART00000014843 Nonsense 34 270 2 2
ENSDART00000075389 Nonsense 42 239 2 2
ENSDART00000131009 Nonsense 34 270 2 2
ENSDART00000132353 Nonsense 62 185 2 2
ENSDART00000144682 Nonsense 34 143 3 3
Genomic Location (Zv9):
Chromosome 7 (position 33260955)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31655295
GRCz11 7 31926445
KASP Assay ID:
554-3151.1 (used for ordering genotyping assays)
KASP Sequence:
GAGCTGCGCCCATGAGAGAGATCCCGGGCGTGCAGGGGGGCCACCGGGCC[G/T]AGGGCTACCTGGGCGCCGCTGCCGCTGCTGCCGCTGCCGTCACATCGGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2376
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014843 Nonsense 34 270 2 2
ENSDART00000075389 Nonsense 42 239 2 2
ENSDART00000131009 Nonsense 34 270 2 2
ENSDART00000132353 Nonsense 62 185 2 2
ENSDART00000144682 Nonsense 34 143 3 3
ENSDART00000014843 Nonsense 34 270 2 2
ENSDART00000075389 Nonsense 42 239 2 2
ENSDART00000131009 Nonsense 34 270 2 2
ENSDART00000132353 Nonsense 62 185 2 2
ENSDART00000144682 Nonsense 34 143 3 3
Genomic Location (Zv9):
Chromosome 7 (position 33260955)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31655295
GRCz11 7 31926445
KASP Assay ID:
554-3151.1 (used for ordering genotyping assays)
KASP Sequence:
GAGCTGCGCCCATGAGAGAGATCCCGGGCGTGCAGGGGGGCCACCGGGCC[G/T]AGGGCTACCTGGGCGCCGCTGCCGCTGCTGCCGCTGCCGTCACATCGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34104
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014843 Nonsense 133 270 2 2
ENSDART00000075389 Nonsense 141 239 2 2
ENSDART00000131009 Nonsense 133 270 2 2
ENSDART00000132353 Nonsense 161 185 2 2
ENSDART00000144682 Nonsense 133 143 3 3
Genomic Location (Zv9):
Chromosome 7 (position 33260657)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31654997
GRCz11 7 31926147
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGATGATCAGCAACCAAGTGCCTTTGGAGCCGCCGTTACTCTTTCTCT[T/A]GGAGGAATACAAAAACTACCTGGATGCCGCCAACATGTCGATGCGTGTGC
Associated Phenotype:
Not determined