Busch Lab

ZMP

esrp2

Ensembl ID:
ENSDARG00000018814
ZFIN ID:
ZDB-GENE-030131-9824
Description:
Epithelial splicing regulatory protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVR8]
Human Orthologue:
ESRP2
Human Description:
epithelial splicing regulatory protein 2 [Source:HGNC Symbol;Acc:26152]
Mouse Orthologue:
Esrp2
Mouse Description:
epithelial splicing regulatory protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924661]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa7075 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21001 Splice Site, Nonsense Available for shipment Available now
sa18517 Nonsense Available for shipment Available now
sa18119 Nonsense Available for shipment Available now
sa38624 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7075
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Essential Splice Site 125 736 4 16
ENSDART00000075089 Essential Splice Site 125 711 4 17
Genomic Location (Zv9):
Chromosome 7 (position 36259501)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34533344
GRCz11 7 34804821
KASP Assay ID:
554-4707.1 (used for ordering genotyping assays)
KASP Sequence:
CGGKCCACTTCTTATTCGACAGGTGCTTCACCCTGAGGCTTCTAAAAAGG[T/C]AAATTACCTTCCAAGCTAAAAACGCTTTCCTTCTTGTGTATTTATGCTTT
Long Flanking Sequence:
TTTATTTTCTTCCGAAAAAGCTGAAATTTTGGAAAGTTTCACAAGCTAATTTCACATGAGCATGTGATATGATTGATCTTGACTGGTAGTCAAGACTAGTCTGGCCTGGCTAGTATTACTTTCTTATCTTCACTTTTTTGAATAATCCCTCAATCCACCCCATCTCCCCCTTTTCCTTCTTTACCAGGGGGAGCTCAATAATTACCTGATCTCAAAACCCCTCACACGCTCATCAACCAGGCGGTAGCCCTGGGGTCAGTTATTTCCGAGTTCAGGGCTCAGGGATATTATTAAGCAATATCTAAGTGTGAACTCTTGAAATAAATGTATAATAGTGCTAATAGTAGGATTTATTTTGTCTGTCTTTCTCTGTTTCTGTCTGTAGTTTCACCAGTCCGTGTCAGCTGAACTAAAGTCACTGGGCCGAAGCTCTTACACACTGTGTGTTGACGGGCCACTTCTTATTCGACAGGTGCTTCACCCTGAGGCTTCTAAAAAGG[T/C]AAATTACCTTCCAAGCTAAAAACGCTTTCCTTCTTGTGTATTTATGCTTTATTCACTCTTACTGATGGCTGTTTAAGGTGTAAATGAAAACCCTACTGTATGTGTTCAACTGTGCATAATTTCTTCTGCCATTTCTAAATTAAGCTATCAGTTTGTGTTATCTGTTTAGCAGCAACATGTTATAATCTTCACAGGAATGTTGTGCTCATCCAGAAGACAATAAAGCACCCAATCCGTTCTGCCTTATACATTTTTCTTCTTCTTTACAGTTTTCCTTTCCCTGAGGCTCCTCCTAAACATATTTTTCTGCTCGCTTTCCTCTCATTTGCCTGTGTGTGTCTTGTTGTAGAATCTAGTCCTGCCAGAGTGCTTCTACACATTTGTAGACTTGAAGAAAGAGTTTCACAAATGCTGCCCCAATGCAGGACCAGTCAAAGACCTCACACTGCCGTCCATGCTGGACTGTATCCTACATATGCCTTTTTTTCAATGCAAATACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2405
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Nonsense 303 736 10 16
ENSDART00000075089 Nonsense 303 711 10 17
Genomic Location (Zv9):
Chromosome 7 (position 36264075)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34537918
GRCz11 7 34809395
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACTCATGCCACTTTGTGNNTTTGTTTCAGGTTTATAAGGCGACCGGGGAG[G/T]AATTCCTGAAGATTGCAGGAGGTRAGACATTTACATGAGGTCTTCAATTC
Long Flanking Sequence:
ATGCAAGTGAATGAAAAGGATGTTAGTAGTAAGTGGTGCACCACACAGCGAACTAAGAATAACTTGTCTTTTTACTTTCACCTCGTCGTAAAATAATTATGTTCTGTCAGTATGCTAAGTGGAGTGCAGGCGTTCTTTGTCATCGAATACATTTGAGCAGCCATAGTGCTTGTACTATGAAAGCAATCCTACTAATTGCTGTTTTAGTGATGGCATTTGGCATTAGAATATCAAAATGTTTCAGTGCTCATTCATATCTAAATTTTATATTGTTCACTTGTGATCAGATAATTGATGACCCATCTTTATGCCAGGTTTAAACAGCACTTAAATGTCATTCCCTTTAATGCATCATCACTAAGATCTGTTAAAACGATTGTCAGCTTCTCTTAGTGGACACATCTGTAATTGGCGCAATGTGATGAATACAGTTAGATATGGTTTTGTGATTAACTCATGCCACTTTGTGTTTGTTTCAGGTTTATAAGGCGACCGGGGAG[G/T]AATTCCTGAAGATTGCAGGAGGTGAGACATTTACATGAGGTCTTCAATTCGAGCAGACACTTTACATTTTGTGGCGTAAATCTCCATTTGTTTTGCGTGCGTGCGTGCGTGCGTGCGTGCGTGTGTGTGTGTGTGTGTGTGTGTCCCTCCATCATTTTCCCCCACTCTGTGGAAATGAAAGACTCTTTGTAAGTGTCTTGCTGACTCATGTTGGGCAGGTAAAGGGGGAAACTCTACTCTCCTTCCCTCCTGTCCTGTGATCTGGCTGGGTCACAAAGAAAGTGAGCTTTTTCCCTTAGGGATGAAGATGGGTCAGCAGCCTCTGAAAAGCTTCACACACAGCAGGTGTAAAAGAGCAGCGGCCTGCCGAGATATCATTACAGAGCGTGTGGATGTGTCTGCTGAAAGCTTTTAGGGCAGCAGAGAGCATCAGTCTGTGACTTCCTATTTTAAATGTACAATTCCTCTTCTTTTGATAGGCACTTCCAATGAGGTGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21001
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Splice Site, Nonsense 489 736 12 16
ENSDART00000075089 Splice Site, Nonsense 489 711 12 17
Genomic Location (Zv9):
Chromosome 7 (position 36265980)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34539823
GRCz11 7 34811300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACACCATTGACATCAAACCTCATGGAGTGCACATGGTCCTCAACCAG[C/T]AGGTGCCTCAGAAAGGCCTGATGTTTCTCGAAACTTGTCATGGGGTCTTT
Long Flanking Sequence:
AAATATTTTTTCCACCAATTCCTAGCAATGCATTTTTGCTGCTCTGTATTGCTATTGTGTATTTGTATATGCATGTCTATATATAAGTGTATGACATAAATATATAATTTAATCCCAAATATAGTGAAAATTAGGCTTTATTTAATTACCTTTTACAAATAGTAGTATATCTGATGATTAATCAGGACTGAAATCCCCCAAAAAACTGTTTATTTGAAAGACTAGAAGATCTTGTCAACTTGACTTTTTTTTGTCTTATAAACTAGGTGTTGAATCGCTATATGTCCACTCCACTGATCTCCACACTTCCACCTCCTCCTCCTCCAATGGTGTCTGTGCCAGTGTTGGCCACTCCACCCTTCATCACCACTGGCAACACACGCGACTGCATCAGGCTGAGAGGCCTGCCGTACACCGCCGCCATCGAGGACATCCTGGAGTTTATGGGGGAACACACCATTGACATCAAACCTCATGGAGTGCACATGGTCCTCAACCAG[C/T]AGGTGCCTCAGAAAGGCCTGATGTTTCTCGAAACTTGTCATGGGGTCTTTAACTTATGTTGAGTATTTTTGTTCTTCTTTTTAGGGTCGACCCTCTGGTGATGCCTTTATTCAGATGAAGTCAGCTGACCGTGCATTTATGGTGGCTCAGAAGTGCCACAAAAAGATGATGAAGGATCGTTATGTGGAGGTTTTCCAGTGCTCCACTGAGGAGATGAGCTTTGTGCTGATGGGGGGAACACTGAACCGCAGCGGTCTGTCACCACCTCCATGCAAACTGCCATGTAAGAGACTGCCTGAAAACCCCTATTCTCAGTGCATGCAATCAATATTCCAAAAATATTTATGCATAATACCAGTTCCAAACCACAGTTGACAATTAAGGGTTGGTTTAATTCTAGGTTTAACACCTACCTTTTCATCTTCATTCTTCCCTCAGTTGAGTGTGCTTTACTTCTAGTCGTTGGTAAAAATTATTCTACATCACTTTACATTAATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18517
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Nonsense 579 736 14 16
ENSDART00000075089 Nonsense 579 711 14 17
ENSDART00000009698 Nonsense 579 736 14 16
ENSDART00000075089 Nonsense 579 711 14 17
Genomic Location (Zv9):
Chromosome 7 (position 36267940)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34541783
GRCz11 7 34813260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGCGTTTCCTGCGGCTCCAGCTATGCTTCCCACTGAGGCAGCGCTGTA[T/A]CAGCCCCCCCTGCYGGCCACTCCAAGAACTCCACAGGCCYCAACACACAG
Long Flanking Sequence:
CTAGTCTGCACTCTTCTGCTGCCATTGGCACGGCTGTTTGAGCTTCAGTTTCAGATTATCTGCTAGAAAGCAGTGTGATCACCTCTGTCACAGATCTAAAGGTGCAACATTTTGGCATTTAGAAAGAGCAAGCCTGTTGCAGCACTAAAGGAGGGGCTGTTTGCTTAGTTATTTGATCTGGTTGTTTGACCTTGGCTTGAGAATTAGCCGTATGTGCTCACGCCACATCAGAGGAGACACTGGTTGTCCCTGTGCCAGTTCAGCTAAATATACATGACATTCACACACTCCAGCAAGGTTGGCTCCTCTCATTTTCACCAAACCACACAAAGTGGAAATGCTAAAAAGTTAATTTACTTAGTGATGATGCATTAGTTAACAAATTTACTAGGGCATCATAATAGAACTTTTTTTATCCTGTGTCTTTCAGGTCTCTCTCCACCAACATATGCTGCGTTTCCTGCGGCTCCAGCTATGCTTCCCACTGAGGCAGCGCTGTA[T/A]CAGCCCCCCCTGCTGGCCACTCCAAGAACTCCACAGGCCCCAACACACAGCCCTGCACCTGCTTTCGCCTACTATTCTCCACAGCTCTACATGAACATGAATATGAGCTACACCACCTACTACCCCAGGTACCACACTTACACAAGCTGGCTTGATTGGATAAATAAGACCTTTTAGCTTTTGTCTAAATTCACTTGATGCCATTTAAAGATACCTTTTAAGGCTGTAATTTTACCTGGTTAAGTTTTGTTGTTAGGAGTAACATATCTGAGATTGTCATTTAAGCATCTTTTAAATGAGCAATATCATACGAGTAGCAGTGTGATATGGCTGTAGGCACTGGTGGGAGGCATGCGTGCCTTAGTGTCCCACCAGTGATGATATACAGCCATTTCGCACTGCTACGCGTGTAATATTGTGTTCATCCAACAGTTTAACATCATCGTTTGTATAATCAAACACAGAGTCTCGAATTATTTTGTACAATGAACTACTTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18119
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Nonsense 579 736 14 16
ENSDART00000075089 Nonsense 579 711 14 17
ENSDART00000009698 Nonsense 579 736 14 16
ENSDART00000075089 Nonsense 579 711 14 17
Genomic Location (Zv9):
Chromosome 7 (position 36267940)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34541783
GRCz11 7 34813260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGCGTTTCCTGCGGCTCCAGCTATGCTTCCCACTGAGGCAGCGCTGTA[T/A]CAGCCCCCCCTGCYGGCCACTCCAAGAACTCCACAGGCCYCAACACACAG
Long Flanking Sequence:
CTAGTCTGCACTCTTCTGCTGCCATTGGCACGGCTGTTTGAGCTTCAGTTTCAGATTATCTGCTAGAAAGCAGTGTGATCACCTCTGTCACAGATCTAAAGGTGCAACATTTTGGCATTTAGAAAGAGCAAGCCTGTTGCAGCACTAAAGGAGGGGCTGTTTGCTTAGTTATTTGATCTGGTTGTTTGACCTTGGCTTGAGAATTAGCCGTATGTGCTCACGCCACATCAGAGGAGACACTGGTTGTCCCTGTGCCAGTTCAGCTAAATATACATGACATTCACACACTCCAGCAAGGTTGGCTCCTCTCATTTTCACCAAACCACACAAAGTGGAAATGCTAAAAAGTTAATTTACTTAGTGATGATGCATTAGTTAACAAATTTACTAGGGCATCATAATAGAACTTTTTTTATCCTGTGTCTTTCAGGTCTCTCTCCACCAACATATGCTGCGTTTCCTGCGGCTCCAGCTATGCTTCCCACTGAGGCAGCGCTGTA[T/A]CAGCCCCCCCTGCTGGCCACTCCAAGAACTCCACAGGCCCCAACACACAGCCCTGCACCTGCTTTCGCCTACTATTCTCCACAGCTCTACATGAACATGAATATGAGCTACACCACCTACTACCCCAGGTACCACACTTACACAAGCTGGCTTGATTGGATAAATAAGACCTTTTAGCTTTTGTCTAAATTCACTTGATGCCATTTAAAGATACCTTTTAAGGCTGTAATTTTACCTGGTTAAGTTTTGTTGTTAGGAGTAACATATCTGAGATTGTCATTTAAGCATCTTTTAAATGAGCAATATCATACGAGTAGCAGTGTGATATGGCTGTAGGCACTGGTGGGAGGCATGCGTGCCTTAGTGTCCCACCAGTGATGATATACAGCCATTTCGCACTGCTACGCGTGTAATATTGTGTTCATCCAACAGTTTAACATCATCGTTTGTATAATCAAACACAGAGTCTCGAATTATTTTGTACAATGAACTACTTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38624
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Nonsense 682 736 15 16
ENSDART00000075089 Nonsense 682 711 15 17
Genomic Location (Zv9):
Chromosome 7 (position 36269822)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34543665
GRCz11 7 34815142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCCGTACAACGCCGGGGTCAAAGACATCCTCAGCTTCTTTCAGGGATA[T/G]CAGGTGACTGCACTTTCTGCTGCTCACTCACTCATTCATTCAGCTTCTCA
Long Flanking Sequence:
AAGCTGCTATAATTTTACCACAAAATCTGCAGAAGCTGGCATGGCGTTAAGATAATAATAAAATTTGTTCTTAAAAATAATTAAGTGTTTTGAAAATCATTGATACTGGAAATAATTTAAAAAAAAGAAATATTCAATATTAATATTTTTTAGTTTACTGTATTTCTAAACAAAAAAATGCGTCTTTGGTGAGCAGAAGAGACTACATTTGCAAGTCTAATTGTGTCATATAACTAACTAATCAACGGATATATGTATCCACATCATAATGCAATATGTTGCCATCAATGGTAGTAAATCTTTTTAAATTTTGTCTCCAGCCCGCCAGTGTCTCCCTCCACTGTGAGTTATTTTGCAGCGCCACCGGGTTCAGTCGCAGCTGCTGTAGCAGCTCAGCCCACCCCTGCCATCCTCCCTCCTCAGCCCGGGGCACTGGTGCGCATGCAGGGCCTGCCGTACAACGCCGGGGTCAAAGACATCCTCAGCTTCTTTCAGGGATA[T/G]CAGGTGACTGCACTTTCTGCTGCTCACTCACTCATTCATTCAGCTTCTCAAGTTCAAAAAACAAAAAAAACAAAAAAGTTCTCCTTTCACCTAAGACCTTACTAGGGCCCCATTTCTCATGGCTAAGCAACAAACAGCTTAAGATTGTTACACTTCTTCTTTCTAAATGTGCCACTGTTAAGATTCTTGCACGCTGAGTCAAACATTTCATATGTCTTCATTTTATCCTAAAAAATGTCACAGTTATACATAGAAATGTTGAAGACAGAGTTTAGTGTGTAATAACAATATATTAAGAACAAATGCAATTTTTATTATAAAAATAAATAAATAAGTAAATAAAATGGACTCTTCAGGCTGAGGATGATGTTCTTGTACTTTGTTTAAAAACACACACAAAAAAGCGAACCTATTTGGCCAACCCAGTCCTGAGATTGTGTAGAAGGAAGGAGAGTTTCAGCTCCTTATTAAGATTGAAAGTTTTCTTCAGTGGCTCAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3639
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 None None 736 None 16
ENSDART00000075089 Nonsense 689 711 16 17
Genomic Location (Zv9):
Chromosome 7 (position 36272940)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34546783
GRCz11 7 34818260
KASP Assay ID:
2259-9129.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGTGGACTGACTGTGGCTCATTGTGCTGTAGCTCAATCCTGAAGACTA[C/A]AGCTCCTTGGTTGGAGTGAGTGATCAGGGCCGGAGTTTCATTCAGCCTAA
Long Flanking Sequence:
TTTCTTCTGAAATGAGCACTGTGTTTGTTCAGTTATTAAATTCTAAAATGTAAAAATATTTTCTACAACCAGGCCATTAAAAAAACAATTCTTAGCCTTTAGATCTGTATAAGTCTGAAACTTTATTTATAATGGTCTTAACAAGGTCTTAAATTGAGGTCTTAAATAAACGATAATATTGTTTCTTGACCACAGGGTTTCTACAGGTTGCACAGTGTTTGAAAACCAGTGTGCTGCTTAATATTTGATTTCAGAATTATTTTAATAATGATATGTTCAAAAGAACACTTATAAAGTCCATTTCAAATCAGAGTATTAATTTATTTCAAACAACTTGAGGTGAATTGGAAGAATTGTCATTGGCACATGTTCTCACCCCTCTATGAGAAGTGTGCTCTGTGAAGTGCTCAGCAGCTGATGTGTATATGAGAGCAGTGCTGAATGTTGAGCTTTGTGGACTGACTGTGGCTCATTGTGCTGTAGCTCAATCCTGAAGACTA[C/A]AGCTCCTTGGTTGGAGTGAGTGATCAGGGCCGGAGTTTCATTCAGCCTAAAGAGTGGCTTTGTCTGTAGGGGGAGCCGCTCCAGGTAAGCTCCCTCGATGCATCTGTGTGACCTGAAGCCATGGCTTGTGCATGGACTAATCCAGTAACGCTCTTTCTTTTCTTCTGATTCCTAGATCTTCACTCTCTGCTTCTTGGATGATTAGTCTCAGAATGCTTTAATCATCCTGTTTTAAACTTGCTGTAATAATAATAATATTAATAATGCTTCTCTCTGATTTGACTAATTGCTTTGGGTTTTGAATGTCTTGTTTATGTATTCCTTGCGTTCTAGAAGTCTTCTGTCTTTGCGAGGGTCTCCTTTTGAATGGTTCTACTCTATAGTGGCTGTGCTAATATATTCTCTCATTCCTTTTCAGCTGATTTGACCGACTTGGTATTTATTGTGTGTCCTGGCTTCATGCAAAATGAATAATTCAAAATCAAATCCGTTTCTCTCCT
Associated Phenotype:
Not determined