Busch Lab

ZMP

slco3a1

Ensembl ID:
ENSDARG00000018726
ZFIN ID:
ZDB-GENE-030131-8662
Description:
solute carrier organic anion transporter family, member 3A1 [Source:RefSeq peptide;Acc:NP_001038653
Human Orthologue:
SLCO3A1
Human Description:
solute carrier organic anion transporter family, member 3A1 [Source:HGNC Symbol;Acc:10952]
Mouse Orthologue:
Slco3a1
Mouse Description:
solute carrier organic anion transporter family, member 3a1 Gene [Source:MGI Symbol;Acc:MGI:1351867]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43116 Nonsense Mutation detected in F1 DNA Not yet available
sa43115 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43116
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013363 Nonsense 131 701 2 10
Genomic Location (Zv9):
Chromosome 18 (position 24940854)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25170627
GRCz11 18 25157159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAATTCCTCGCCAGTCAATACAAGATCACAGACACTTGGAGCAAAGAT[C/T]AGGGCCGAGATGTTTGCTCCAACACCTCAAAAGCTGATGAACCATGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43115
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013363 Nonsense 219 701 3 10
Genomic Location (Zv9):
Chromosome 18 (position 24880452)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25110225
GRCz11 18 25096757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGGACCTGCATGTGGTTTCATCCTGGGATCTGTCTGTACCAACTTTTA[T/A]GTGGATGCTTTGTTCATCGACACAAGTGAGTTTCTCTTTATCCTCTGCAC
Associated Phenotype:
Not determined