Busch Lab

ZMP

si:ch211-93a19.1

Ensembl ID:
ENSDARG00000018716
ZFIN ID:
ZDB-GENE-070912-328
Description:
hypothetical protein LOC100137124 [Source:RefSeq peptide;Acc:NP_001108193]
Human Orthologue:
DGKH
Human Description:
diacylglycerol kinase, eta [Source:HGNC Symbol;Acc:2854]
Mouse Orthologue:
Dgkh
Mouse Description:
diacylglycerol kinase, eta Gene [Source:MGI Symbol;Acc:MGI:2444188]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa11568 Essential Splice Site Available for shipment Available now
sa8698 Nonsense Mutation detected in F1 DNA Not yet available
sa34602 Nonsense Mutation detected in F1 DNA Not yet available
sa41389 Nonsense Mutation detected in F1 DNA Not yet available
sa34603 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa34604 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10472 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11568
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 None None 1194 None 28
ENSDART00000026174 Essential Splice Site 16 1235 1 30
ENSDART00000060356 None None 588 None 16
Genomic Location (Zv9):
Chromosome 9 (position 18302332)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17778402
GRCz11 9 17786114
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGGAAGATGACTGCCAATATACTCGCAGCCCTGCCTGGGAAGAACTGG[T/G]CAGTACTGCTGAACATTTTCTAWTCKGACAGACGTCAAAGAGATCCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8698
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 Nonsense 90 1194 2 28
ENSDART00000026174 Nonsense 102 1235 3 30
ENSDART00000060356 None None 588 None 16
Genomic Location (Zv9):
Chromosome 9 (position 18346563)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17822633
GRCz11 9 17830345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCGTTGGAAAAAACGTTATTTCAAGCTACGAGGACGGACRCTCTACTA[T/A]GCTAAGGATGYCAAGGTGMCTTTTCCACCACACAGGCCTGCTGTAGTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3711
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 Nonsense 271 1194 7 28
ENSDART00000026174 Nonsense 283 1235 8 30
ENSDART00000060356 Nonsense 132 588 4 16
Genomic Location (Zv9):
Chromosome 9 (position 18404253)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17880323
GRCz11 9 17888035
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGCTGTTTGCGACAAAACATGTGGCAGCGTGCTGCGCTTGCAGGACTG[G/A]CGCTGTTTGTGGTGCAAGGCCATGGTAAGAACTACATATCCCAGAATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34602
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 Nonsense 367 1194 9 28
ENSDART00000026174 Nonsense 379 1235 10 30
ENSDART00000060356 Nonsense 228 588 6 16
Genomic Location (Zv9):
Chromosome 9 (position 18415516)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17891586
GRCz11 9 17899298
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCTCAATCCTGCTCAGGTCTTTGACCTGGTCAACGGTGGACCTCATT[T/A]AGGGTAAGACCAGGATGTCAGAGGTCATGGAGTATGAACTAAATCAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41389
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 Nonsense 460 1194 12 28
ENSDART00000026174 Nonsense 472 1235 13 30
ENSDART00000060356 Nonsense 321 588 9 16
Genomic Location (Zv9):
Chromosome 9 (position 18419394)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17895464
GRCz11 9 17903176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACATCTGCAGCTGCTGTTTACAGGTGGAGTATAATGACGTATGAGATT[A/T]AAATACCTCCCAAACACAGCTGTCCTGCTACGCCTGAGGAGGCAGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34603
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 Splice Site, Nonsense 479 1194 13 28
ENSDART00000026174 Splice Site, Nonsense 491 1235 14 30
ENSDART00000060356 Splice Site, Nonsense 340 588 10 16
Genomic Location (Zv9):
Chromosome 9 (position 18423798)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17899868
GRCz11 9 17907580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCAAGATGCAAGCATGGCATGATGTGATCCGTTTTTCTGGTTTTAGT[T/A]ACAGATATCAGCTTATGAGGATTCAGTGGCTGCTCATCTCACAAAGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34604
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 None 1194 1194 28 28
ENSDART00000026174 Essential Splice Site 1207 1235 29 30
ENSDART00000060356 None None 588 None 16
Genomic Location (Zv9):
Chromosome 9 (position 18456428)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17932498
GRCz11 9 17940210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGACATCCGCGGCTCCGAGCTCCTGCACCTGGAGAGGAGAGACCTTAAG[G/A]TATACACACAACCCCTTTTCTGTGCCTCACGATGTCCCTCAGATCAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10472
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 None None 1194 None 28
ENSDART00000026174 None None 1235 None 30
ENSDART00000060356 Nonsense 548 588 16 16
Genomic Location (Zv9):
Chromosome 9 (position 18476436)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17952506
GRCz11 9 17960218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCATTTAGGAGAAGTGCGACGCGAGTTTCATTTGTTTACATTGTGTTTA[C/A]GATTGGCACAGTTTCATTTTTAAGACTACATGTATAGCTATATTTACAAA
Associated Phenotype:
Not determined