Busch Lab

ZMP

itga2b

Ensembl ID:
ENSDARG00000018687
ZFIN ID:
ZDB-GENE-051031-1
Description:
integrin alpha-IIb [Source:RefSeq peptide;Acc:NP_001003857]
Human Orthologue:
ITGA2B
Human Description:
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41) [Source:HGNC Symbol
Mouse Orthologue:
Itga2b
Mouse Description:
integrin alpha 2b Gene [Source:MGI Symbol;Acc:MGI:96601]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa83 Essential Splice Site Confirmed mutation in F2 line Not yet available
sa40053 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19 Nonsense Confirmed mutation in F2 line Not yet available
sa40052 Nonsense Mutation detected in F1 DNA Not yet available
sa30831 Nonsense Mutation detected in F1 DNA Not yet available
sa10134 Nonsense Available for shipment Available now
sa40051 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa26046 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3468
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 98 1037 2 30
ENSDART00000016562 Essential Splice Site 98 1037 2 30
Genomic Location (Zv9):
Chromosome 3 (position 21593666)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21250057
GRCz11 3 21380605
KASP Assay ID:
2259-3340.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGRCAACAAGAGGACAATCATGTCAGACCTTAAACTTTGACCAAAAAG[G/A]TGAGTAAACTCCTCCAGTATGTACTGTATATGGAATACATACCAAAATAG
Long Flanking Sequence:
CCACCAACTTCTCTGTTTTATGCAGCGGATGCCCTTCCAGCTGCAACCCATCACTGGGAAACATCCATACACACTCGTTCACACACATACACTATGGATAATTTAGCCTATCCAATTCTTTGGAGTTGTGCTGGAAACCGGAGCACATGCAACGAACACGCAAACTCCACACAGAAACGCCAACTGACCCAGCCGAGGATCGAACCTTCTTGCTGTGAGGCGAACGTGCTACTCACTGTGCCACTGTGCAGCCCATCTACTATTTTTAAATTACTAAACTTTTTATCTATAATTAATTATACTGCATATACTATAAACTACACTATAACTAAAAATATATGGCTATTTTTCTCTGTTTTCCCCTTGCAGTGTAAGTGTGGTGGTTGGAGCTCCAAGAGCAAACACAAATCAGTCTGGGGTCTCTCATGGTGGCTCTGTCTTCATGTGTCCCTGGGCAACAAGAGGACAATCATGTCAGACCTTAAACTTTGACCAAAAAG[G/A]TGAGTAAACTCCTCCAGTATGTACTGTATATGGAATACATACCAAAATAGCCAGATTTTACTGCCAGAATAACTGTAGACAATTTTATACTGATTCATAAAAGCTGCCGATCTGTCTTTTTTTCTACATTCCAAATGTTAAAAAGTTTAATATACAGCACTGCAGCTCTTATTTTGTAATAATTCAACATTTGTAAACTGATGTTCAATGTTCGTTTTTTTGGAAACGTCAACCAAAAAATGTTTCTATCATCATTAACTAACCCCTAACATTTTCCAAACCAGTTTGAGTTTGTTGGTTTGAAGACATTTCAAATAATATTTCAAACAAGTAACTATTTATATCTATGCAAGGAAAATATAAGTCAACAGGTACTGGTTTCCAACATTCATTCATTCCTTCATTCAATTATTTGTTTTCTTTTCGGCTTAATCTCTTTATTAATCGATGGTTGCCACAGTGGAATGAACCCCCAACTTATCCAGCATATGTTTTACGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18752
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 98 1037 2 30
ENSDART00000016562 Essential Splice Site 98 1037 2 30
Genomic Location (Zv9):
Chromosome 3 (position 21593666)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21250057
GRCz11 3 21380605
KASP Assay ID:
2259-3340.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGGCAACAAGAGGACAATCATGTCAGACCTTAAACTTTGACCAAAAAG[G/A]TGAGTAAACTCCTCCAGTATGTACTGTATATGGAATACATACCAAAATAG
Long Flanking Sequence:
CCACCAACTTCTCTGTTTTATGCAGCGGATGCCCTTCCAGCTGCAACCCATCACTGGGAAACATCCATACACACTCGTTCACACACATACACTATGGATAATTTAGCCTATCCAATTCTTTGGAGTTGTGCTGGAAACCGGAGCACATGCAACGAACACGCAAACTCCACACAGAAACGCCAACTGACCCAGCCGAGGATCGAACCTTCTTGCTGTGAGGCGAACGTGCTACTCACTGTGCCACTGTGCAGCCCATCTACTATTTTTAAATTACTAAACTTTTTATCTATAATTAATTATACTGCATATACTATAAACTACACTATAACTAAAAATATATGGCTATTTTTCTCTGTTTTCCCCTTGCAGTGTAAGTGTGGTGGTTGGAGCTCCAAGAGCAAACACAAATCAGTCTGGGGTCTCTCATGGTGGCTCTGTCTTCATGTGTCCCTGGGCAACAAGAGGACAATCATGTCAGACCTTAAACTTTGACCAAAAAG[G/A]TGAGTAAACTCCTCCAGTATGTACTGTATATGGAATACATACCAAAATAGCCAGATTTTACTGCCAGAATAACTGTAGACAATTTTATACTGATTCATAAAAGCTGCCGATCTGTCTTTTTTTCTACATTCCAAATGTTAAAAAGTTTAATATACAGCACTGCAGCTCTTATTTTGTAATAATTCAACATTTGTAAACTGATGTTCAATGTTCGTTTTTTTGGAAACGTCAACCAAAAAATGTTTCTATCATCATTAACTAACCCCTAACATTTTCCAAACCAGTTTGAGTTTGTTGGTTTGAAGACATTTCAAATAATATTTCAAACAAGTAACTATTTATATCTATGCAAGGAAAATATAAGTCAACAGGTACTGGTTTCCAACATTCATTCATTCCTTCATTCAATTATTTGTTTTCTTTTCGGCTTAATCTCTTTATTAATCGATGGTTGCCACAGTGGAATGAACCCCCAACTTATCCAGCATATGTTTTACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa83
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 131 1037 3 30
Genomic Location (Zv9):
Chromosome 3 (position 21592561)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21248952
GRCz11 3 21379500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACCAGTGGTTGGGTGCTTCAGTTCGAACCTACAACAACTACATCTTGG[T/A]GAGTTACTGTGAGTTCCTTAACCACACTATTCTTCCTGTCAAAGCTGTAT
Long Flanking Sequence:
CATGTCTTTCGACTTCTGAGGGAAACCAGAGCACCCCATGCCAACACCAGGAGAACATGCAAACTCCACACAGAAATGCCAACTGAGCCGACAGTGCTACCCACTGCGCCACCATGCTGCCCCAGATTCCAACATTCTTCATTTATTCCTATGTGTTCAAGAGAACAAACAAATGGGCTTGGAACATGTGAGTACAGGGTGAGTCAATGACAGAATTTTCATTTTAGGCTGAACTGTCATTTTGAATAAAAAACACACAAGAATTGAATCAAAACAAAATGAAAGCTTGCAAATCAGTTACAATTTGATTTTTGTACCCAGTATGTACAGCATATAATGGAATGCCATTTCACATAAAGACATATTGTTCCACACGTTTTTTCTCAATCCATTACTCAAAGGTGATGAAAATATTACATTTGGTAACATGCTCCTAATGGCTCACAAGTCGAACCAGTGGTTGGGTGCTTCAGTTCGAACCTACAACAACTACATCTTGG[T/A]GAGTTACTGTGAGTTCCTTAACCACACTATTCTTCCTGTCAAAGCTGTATATTCATTAGACTGGAGTCTAGTTATTAATAGCATGCATATTAAAGGGCCTTCAGATTTTTTCTCAAGCAATACATGTTTTACATTTAAAATATGGTAAGGTTATTTAGCCTGTTAGCCAATTTTTTTTACTTTTACTCTAGAAATCACTGTTAAACCATGGTTAGTCCAGTAAAAACACTGCTTTGTGGTCACCATAGTTTAAAAGGATTTTTAATTTTACATTTTTAAAAATATGTTTTATAAGATGTTTAATTAGAATTTCTATTTGTCTATCTGTTGTAAAGTGCACACTGCTAGCATTGTTTTTGTGGACAGTGTCCCATAACGAACGGTTTCTGTTTACCTCCTCATGCAAACGGGAGACAGGCCTGTGCCCCATTGTTTCACTGGAACGTCCTCGTGGACCAAGAAGAAGCCATGAACACACCTGTGGGGAACTGTCAGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40053
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 287 1037 9 30
Genomic Location (Zv9):
Chromosome 3 (position 21589832)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21246223
GRCz11 3 21376771
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCAGATTATGTTGTTGGCGTCCCAAATGATCTGCACACTGCAGGCTCT[G/T]TAAGTGTTCTTGTTACTTGGATAATAATGCACTTCAATTATGGTCTTGCT
Long Flanking Sequence:
TTGTTGGTTGGGTTTAGGGAAGTGGGTGGGTGGGTCAGTCGATCGGTCAGTCAGTCAAACAGTCAGTTGACAGTGGCCTCTGGTGGATTTTTGAGAGAACAGCGGATGGCACTCGCAAGAGAAATTTGAGATCTCAAAAAGACAATTCAATGACAATTAAGAGTTATATTCTGAAATGAACAGAAGACTAAATTATTAATGCTTAACAAATGATTTGTAGTGTGCAGTTTTTATAAAGTGTTACCAAATAAATTATGATGACAAAACAATTCAATGCAGTCACATAATTTTCATTGTAGGATACTCTGTTGCTGCTGGGAAGTTTAATAATGACAACATCCCAGGTAAAAAATAATAATTTTTTTTACACTTTTATTCAGAAACATGCAACTTTTTTTATACAAACCGTAATTGGACATTATTTTCCTGTTGTTCTTTATTTAATGTATATTGCAGATTATGTTGTTGGCGTCCCAAATGATCTGCACACTGCAGGCTCT[G/T]TAAGTGTTCTTGTTACTTGGATAATAATGCACTTCAATTATGGTCTTGCTCAGATAAACAATTGATTAATGATTGGTAAATTGAATGATGATTGGTTGTTTAACTGTGCTTTTTTTAGGTCAAAATAATAAATGGAGCAACCGTGCCTCTACAAATCATGAAGGCAATTAGTGGCACCCAGGTTAAACATTTATTTGTGGTTGCATTTTATTATACAGAAAATGGGTCAGGATGTGATATCTTTAAACTGTTCTCAAATGTGCATCAATAGTTTTTTTTTTTTCATGTGTGTTTATTTTTGTTATTCATTTTATTCCTTTATGAAATATTAAATTCACAAAAATGAAAGAAAAATAATTGCCATGCCTTAATGCCTTCCATCTTCCCACCAGATGAAGTGACTTGATCACTTGGAGATAGTTACATGTCTTTTTTTTTGTCAGTGCTTTAGAGATTGTGATGACTTTTTTAAAACCGATGAGTTGACCAGAAAGTAGGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26047
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 351 1037 12 30
Genomic Location (Zv9):
Chromosome 3 (position 21588648)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21245039
GRCz11 3 21375587
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCACTTTTTATGGAGCAGCTGTCCACGCAGAAATTTCGAGAAGTGGGA[C/T]AGGTGTATGTTTACCTGCAAAGAAATGACTTCTCCTTCGCCTCCAGACCC
Long Flanking Sequence:
GATAAAAGTAGGAATAGTGTGGGGTTTTAGCTAATATTTCCAAGACATTATATCACGTAATACACAAACAAACAATTTTATTCAAGAGATAACAATGTATTTTGTTTTGTTATTCAAAACTGTTTTGCTATTTTTTTTATATATATTTTGAAGGTTTATCTTAGAGACACAAAATGTACTCCCAATTCTAGAATCACCGATAAGCTCCTATATGTAAAAATGAACACTAAACATTCTCATGCAGTAATGTTTACTTTTTTTATCTTGTCTCCTGCAGATAGCATCTTATTTTGGACATTCTGTAGCAGTAACAGACATTAACAGAGATGGGTAAGTTATACCTCAGAGACCAGTTGATCCTTCTGGTAGTTCATGAGGTTTTATTAAATGTTTTCTAGATTAATTATACTCCATCTGTGGCCTTCAGGTGGGATGACATCCTGATTGGAGCGCCACTTTTTATGGAGCAGCTGTCCACGCAGAAATTTCGAGAAGTGGGA[C/T]AGGTGTATGTTTACCTGCAAAGAAATGACTTCTCCTTCGCCTCCAGACCCAACCAGATCCTGGCCGGGACATATGCATATGGGCGTTTTGGCAGCGCCATAGCACCTTTGGGAGACCTCGACCATGATGGTTTTAATGGTGAGGGGACATTAGAGCACTTTTAACTGTGAAAATAACACATCTTAATATTTTCATGGATAATTCTGAGCACAAACCACCCACTTCAAATGTCATCACTCAATTGAATGTGTTGTCAGCTAATAGATATGGGCTAGTAGGGGCTGTTATCACCCATCCACATGGTTAATCAGCTATACTAATGAAAAAGACTCCAGATTTGTTTTTACATTACTTTGACGGTTGGGTTTAGGGTTGAGGTAGGGGTAGACATTAATAAAATACAATTAATGGGAAATTTTTATAAATAGTATAAATAATTACTACTACTAGTATTGGGTGTAGAAGGCTACTACTGGCCCATATCTATCACTTGATAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 355 1037 12 30
Genomic Location (Zv9):
Chromosome 3 (position 21588634)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21245025
GRCz11 3 21375573
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCAGCTGTCCACGCAGAAATTTCGAGAAGTGGGACAGGTGTATGTTTA[C/A]CTGCAAAGAAATGACTTCTCCTTCGCCTCCAGACCCAACCAGATCCTGGC
Long Flanking Sequence:
TAGTGTGGGGTTTTAGCTAATATTTCCAAGACATTATATCACGTAATACACAAACAAACAATTTTATTCAAGAGATAACAATGTATTTTGTTTTGTTATTCAAAACTGTTTTGCTATTTTTTTTATATATATTTTGAAGGTTTATCTTAGAGACACAAAATGTACTCCCAATTCTAGAATCACCGATAAGCTCCTATATGTAAAAATGAACACTAAACATTCTCATGCAGTAATGTTTACTTTTTTTATCTTGTCTCCTGCAGATAGCATCTTATTTTGGACATTCTGTAGCAGTAACAGACATTAACAGAGATGGGTAAGTTATACCTCAGAGACCAGTTGATCCTTCTGGTAGTTCATGAGGTTTTATTAAATGTTTTCTAGATTAATTATACTCCATCTGTGGCCTTCAGGTGGGATGACATCCTGATTGGAGCGCCACTTTTTATGGAGCAGCTGTCCACGCAGAAATTTCGAGAAGTGGGACAGGTGTATGTTTA[C/A]CTGCAAAGAAATGACTTCTCCTTCGCCTCCAGACCCAACCAGATCCTGGCCGGGACATATGCATATGGGCGTTTTGGCAGCGCCATAGCACCTTTGGGAGACCTCGACCATGATGGTTTTAATGGTGAGGGGACATTAGAGCACTTTTAACTGTGAAAATAACACATCTTAATATTTTCATGGATAATTCTGAGCACAAACCACCCACTTCAAATGTCATCACTCAATTGAATGTGTTGTCAGCTAATAGATATGGGCTAGTAGGGGCTGTTATCACCCATCCACATGGTTAATCAGCTATACTAATGAAAAAGACTCCAGATTTGTTTTTACATTACTTTGACGGTTGGGTTTAGGGTTGAGGTAGGGGTAGACATTAATAAAATACAATTAATGGGAAATTTTTATAAATAGTATAAATAATTACTACTACTAGTATTGGGTGTAGAAGGCTACTACTGGCCCATATCTATCACTTGATAACCACTGATAACGTCCAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40052
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 405 1037 13 30
ENSDART00000016562 Nonsense 405 1037 13 30
Genomic Location (Zv9):
Chromosome 3 (position 21584159)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21240550
GRCz11 3 21371098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCACGTGTATTCATTTCTCCTCAGATGTGGCAGTGGGAGCGCCTGGTT[C/A]AGTTGATGGGGGTAAAGTGTTTATTTACCTGGGTAAGAGTGGTGGTTTGA
Long Flanking Sequence:
CTGTAAAAAAAAAAATCTGTTAATTAACAGTTCGATATTTTGTGATTCACAAGTGTTTTCTACTATTTACGGTTGTGAATTGAATTATGGTACCTCGATCTCTGCTCAGTTGACTTATAAAGTTGAAAATTCAACTTTACAGTTTACCAAAGTTACTTTTATTGACATTTTATTTGTTGGAAACAATATAATGTGAGAAATATTATGTAGAGAAATAAGTCTGTAAAATGTACCAAAAATGTACTGGCAGCTTATTGCAAGGTTTTTGTACCGTAGGTACAACATCAACCCAGACAATATATCACCTTAAACTATTAAAAATGTTGTTGAAAGAAAGACCAAGGTCCCATAAAGCAGAAAAAGCATAAATCCACTTGGTAAACATGGGTAAAATTAAAACATGAATTACAAAATACAGAAAACTGCTCAGTTATGGATATTTTTATAATGTAGCACGTGTATTCATTTCTCCTCAGATGTGGCAGTGGGAGCGCCTGGTT[C/A]AGTTGATGGGGGTAAAGTGTTTATTTACCTGGGTAAGAGTGGTGGTTTGAGCACCCAGTATGTCCAGGTCATCGAGAGCCCATTTCGCAGCCTCATAGATCCTCCAATGTTCGGCTTCAGCATAAGGGGAGGGACAGATATTGATGATAACGGATATCCAGGTACTGTATGTAATACATTGTTTAAAAACCTCTGATGATTTAGTTCTTGTCTCATTCCAGAAATAATGTAAAATGTTTAAATATGATAGGAAACATTTGATTGTCCACACATGACAATGACAGTAAACTTGATTTTACCTGACAGAGTTGACATTGTCAGCCATTTTGTGCTTTAACTCAAAATGCTAAAAAAAATTAGAAGGTTCATGAGAAATTCACTAAAGTATCACAAAAACAGAGTTGAGAAATAATCAATCTATTGATGTATCCTAAACATTTTTTGTACAAATTAATGAAAGAAGAATAATAACATGGACGTAACATGGATAGATAATAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30831
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 405 1037 13 30
ENSDART00000016562 Nonsense 405 1037 13 30
Genomic Location (Zv9):
Chromosome 3 (position 21584159)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21240550
GRCz11 3 21371098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCACGTGTATTCATTTCTCCTCAGATGTGGCAGTGGGAGCGCCTGGTT[C/A]AGTTGATGGGGGTAAAGTGTTTATTTACCTGGGTAAGAGTGGTGGTTTGA
Long Flanking Sequence:
CTGTAAAAAAAAAAATCTGTTAATTAACAGTTCGATATTTTGTGATTCACAAGTGTTTTCTACTATTTACGGTTGTGAATTGAATTATGGTACCTCGATCTCTGCTCAGTTGACTTATAAAGTTGAAAATTCAACTTTACAGTTTACCAAAGTTACTTTTATTGACATTTTATTTGTTGGAAACAATATAATGTGAGAAATATTATGTAGAGAAATAAGTCTGTAAAATGTACCAAAAATGTACTGGCAGCTTATTGCAAGGTTTTTGTACCGTAGGTACAACATCAACCCAGACAATATATCACCTTAAACTATTAAAAATGTTGTTGAAAGAAAGACCAAGGTCCCATAAAGCAGAAAAAGCATAAATCCACTTGGTAAACATGGGTAAAATTAAAACATGAATTACAAAATACAGAAAACTGCTCAGTTATGGATATTTTTATAATGTAGCACGTGTATTCATTTCTCCTCAGATGTGGCAGTGGGAGCGCCTGGTT[C/A]AGTTGATGGGGGTAAAGTGTTTATTTACCTGGGTAAGAGTGGTGGTTTGAGCACCCAGTATGTCCAGGTCATCGAGAGCCCATTTCGCAGCCTCATAGATCCTCCAATGTTCGGCTTCAGCATAAGGGGAGGGACAGATATTGATGATAACGGATATCCAGGTACTGTATGTAATACATTGTTTAAAAACCTCTGATGATTTAGTTCTTGTCTCATTCCAGAAATAATGTAAAATGTTTAAATATGATAGGAAACATTTGATTGTCCACACATGACAATGACAGTAAACTTGATTTTACCTGACAGAGTTGACATTGTCAGCCATTTTGTGCTTTAACTCAAAATGCTAAAAAAAATTAGAAGGTTCATGAGAAATTCACTAAAGTATCACAAAAACAGAGTTGAGAAATAATCAATCTATTGATGTATCCTAAACATTTTTTGTACAAATTAATGAAAGAAGAATAATAACATGGACGTAACATGGATAGATAATAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10134
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 616 1037 19 30
Genomic Location (Zv9):
Chromosome 3 (position 21574371)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21230762
GRCz11 3 21361310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTACTATTAATTCCCCTAACCTGCTGAAAACTGTTTCTTCTGTTTAGACA[C/T]GAATAATACTAAACTGTGGTCCTGATAATGTCTGTAWTCCAGACCTGCAG
Long Flanking Sequence:
TAATTAATTTTATTTAAATAAACAATTTTTACATAAATAATGGTTTAAATGAATGATTCAGTAACTTACTCATTAAGTCAGACTTCATTATTAGCTTAATCAGTGTTCTTGAATGAACCAATTTAATAAGTGATTCCTTAACAAATTATATGTTAACAGATGCTTTTCCCTCCTATTCATAACAATATAATTAAGTTGCTCTCAAAAGCTTAGAAAAGACAACGGTGATACACCTTAGACATCAATGATAATAGATGTTACCTGTAAACCTTTTTCATAGTACTTCTGTGATAGCTTGACTTTTTGTAACACAGAAATACAATGATCACATATTTTTAAATGTACATCTTCATATTCACAGACAAAGCGCAATAAGCCATTTAGGAATAAAATTGTGTGGGTGTTTTAATTAAGATCACAGTCCTTTAACAATTAATCACCTCATGTAGGCTACTATTAATTCCCCTAACCTGCTGAAAACTGTTTCTTCTGTTTAGACA[C/T]GAATAATACTAAACTGTGGTCCTGATAATGTCTGTATTCCAGACCTGCAGCTGAAGGCAGTAGCGTAAGTTTTGTTAGCTATACAGTAAAAGTTTTAGATTACAGGCATTTATCTCAAACAAGCTATTTTTTTTTCTGAAAACAGGTCAACAGAACCAATCCTGATCGGCGATGAGAATCCAGCGCTGCTGATTATCGAGGCTGAGAATCAGGGAGAAGGAGCCTATGAGACTGAGCTCTATATCAGCCCACCGGCAAACACACACTATCAGGGTGTTTTGAGCAACCATGAGGTGAGGGTTTAGTCACTTCCTGTTTGTTACTGACAGAATCACAAAGTGCAAGATATCAATTTCAATCATGCTGTTGAGTGAAAGAATCTGTTTGGACATTCATATCAAATTGCATGTAAAATAAATGATGGCTTATAGAAAGTAGATTTGAACACATTAAAATGAAAATGGTTGTTAAAACTAACAATACTGATACAAACATTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40051
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 718 1037 22 30
Genomic Location (Zv9):
Chromosome 3 (position 21573424)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21229815
GRCz11 3 21360363
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAGCCCACTGTGGAACATCCCGCTCTCTGTTGTTTTTCTCATTCA[G/A]CTGAAAGCAGGTCTTTACTTCAGCATGGGTGATCTGGAACAGGTGGAGAA
Long Flanking Sequence:
ACATTAAAATGAAAATGGTTGTTAAAACTAACAATACTGATACAAACATTTAAAAAACGTTGCTTTAATTGCATATAATCTTTAAGCTAACATAAGTTAATAGTTAAAAAGTAACCACACAAACCACCCAAGGGTTTGTCTGAACAAGATTTGCATATGAAACTGTCTTTGGTTCGTCAGAAAACTAAATCAGGCCTAACAAATGATATCTGACTGTCCTCTTTCTGTCAGTGCGCTTATTTTATATTCATGCACAAATTAGAGTTATTTCCGGGTCACATACGGTTTAAAATGTGTGGTTGCAGGATTTCAGTGCCTTGGTGTGTGGTCAGAAGAAGGAGAACGGCTCAGTCATTGTGGTCTGCGATCTGGGAAATCCCATGGAGGCCGGACAACAGGTCAGAGTGACATAATGAAGACAAAAACACACCTCAGATGATTTGACCGTTAATTTTCAGCCCACTGTGGAACATCCCGCTCTCTGTTGTTTTTCTCATTCA[G/A]CTGAAAGCAGGTCTTTACTTCAGCATGGGTGATCTGGAACAGGTGGAGAACCACATCACATTTCAAATGCAAATACGAAGGTGTGAACACCCATAAACACACCATCTGTGCTGTTAGCAAAACAAAAACGGCACAAAATGATGTCTCTTTTTTTTCACGGTACATTTTGCTCATGATGACAGTGTTCATTATATTCTTTTGATCTCTTTTATAATTTTTTTTAGTAAGAACAGCCAGAACTCAGATAGCAACCTGGTCCAATTGCAGGTTAATGTAACTGCTGTCGCTTCCCTGGAGATGCGTGGGTTAGTGCCGCTGTCTTTTTCTCATGTCTCTTTGTTTTCCCCCTATTACAAGAGAGAGCATAAAACTGAAAGGAGATAATGACTGGTTGGCTATAAAGAAGTATGCATGTCCATAATCATAAACGAGGATTGTTATTTTCCGCATCACTGTGACAAATCAGGTACAATGTTAAAAGTAAAATTGGTTTGGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26046
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 1009 1037 29 30
Genomic Location (Zv9):
Chromosome 3 (position 21564562)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21220953
GRCz11 3 21351501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTCGCTGGACTGCTTCTATTGGCTGCGCTGAGCACCATCTTCTGGAAG[G/A]TACTTCTATGGGTTTAACAGCAGAGGGAGCTATAATTGTCCCTTAAAGAT
Long Flanking Sequence:
TTGATCATTAATAAAATTATCGAGCCCAACTGTTATTAAGATCAAAAAAGTAATACATTTTACAGTTTTTTACATCATAAAACTGAATGTATATTTTTACAGCAAAACAGCCAATCAAAAATAAATAAATAAATAAATATGGCACATTCTGATACAAATTTTGTTTCAATTTTTTAAAGTTCCAATAATAAGCTGGTTATACACAATCTACATTGTGAAAGTGCTATAGAACTAAAGATGATTTGAAGAGAATTTTTTGAGAAAAGCTGCCCCCAATCAGATATTTTAGGCCACACACAAAAAAATATCAAATGATTTCCTGGAAGGACAGCTACTGTAAGCACTGGGCTCGTAATAAAAAAGCTCTATCTATGTAGACTCACACAAAAATAATTTGGCGAAGCCCTGATGGACAAGAGGAGGTACCTTTGTGGTGGATCGTAGTGTCAATCGTCGCTGGACTGCTTCTATTGGCTGCGCTGAGCACCATCTTCTGGAAG[G/A]TACTTCTATGGGTTTAACAGCAGAGGGAGCTATAATTGTCCCTTAAAGATCTGCGAGCTCAGGGGTGGCCAACGCTGTTCCTGGAGAGCCACCTTCCTGCAGATTTCAGTTGCAACCCATATCAAACACACCTGCCTGTAATTATCACGTGTTGTTCAGGTCCTAATTAATTGATTCAGGTGTGTTTGATATGGGTAGCAACTAAAATCTGCAGGTAAGGGGCTCTCCTGGAACAGGGTTGCCCACCCCTGTACTAGATAAAGATAAACAAACATCTCTGTTAAGTTAACAGATCATGCTTACACCTTGAATCTTCATCCATGTTAACAATATTATAAAACTCTGTATGTTTTAAGATGGGGTTTTTCAAGCGTAACCGTCCTCCATCTGATAATGATGACGATGATGATGATGATGTCACTCAGCAGCTGAATGGAGACTGAAGTCAGACTGCAAATCTTGAGCTTTGTGATGCTGTATGACTTTTAAAATTGTGTTTG
Associated Phenotype:
Not determined