Busch Lab

ZMP

igf2a

Ensembl ID:
ENSDARG00000018643
ZFIN ID:
ZDB-GENE-991111-3
Description:
insulin-like growth factor 2a precursor [Source:RefSeq peptide;Acc:NP_571508]
Human Orthologue:
IGF2
Human Description:
insulin-like growth factor 2 (somatomedin A) [Source:HGNC Symbol;Acc:5466]
Mouse Orthologue:
Igf2
Mouse Description:
insulin-like growth factor 2 Gene [Source:MGI Symbol;Acc:MGI:96434]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27041
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009642 Essential Splice Site 123 197 3 4
Genomic Location (Zv9):
Chromosome 7 (position 50329001)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48599237
GRCz11 7 48872013
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCCTCCTCCTCGCTGCAGGTCTTCCCAGTGTCACAGGCTCTTCACAAG[G/A]TACATGAAGCTGCTTATCTCCCCCTCCCCCCTCCACCGAAAAGCCCAGCA
Associated Phenotype:
Not determined