Busch Lab

ZMP

zgc:101797

Ensembl ID:
ENSDARG00000018605
ZFIN ID:
ZDB-GENE-041114-99
Description:
tektin-1 [Source:RefSeq peptide;Acc:NP_001007398]
Human Orthologue:
TEKT1
Human Description:
tektin 1 [Source:HGNC Symbol;Acc:15534]
Mouse Orthologue:
Tekt1
Mouse Description:
tektin 1 Gene [Source:MGI Symbol;Acc:MGI:1333819]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17016 Nonsense Available for shipment Available now
sa42585 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14123 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17016
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041590 Nonsense 203 398 5 8
Genomic Location (Zv9):
Chromosome 15 (position 32001623)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34014924
GRCz11 15 33872903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNNNNNNNNNNNNNNNNNNNCCACATCACCTGATTTAAATRAAGGAAATTCAAGCTTTAAATA[T/A]TCCGGGTAAGATAAGAAAACATGTTTCTGTGGAAAATGTACTTCRGATCT
Long Flanking Sequence:
AAACTGTAAATAATAAAATTATAAATTGTTATCAAATTGTCAAATTACAATCAATTATCAGTATTTAAAAAACTTATAAAACAATTTAAATGAATGAATCAAATAATAAATAATCAACATTTTTTCAGATGTTACAAAATAATAATAATGAATACATAAACAATTTATTGAGAATTCATTCATAATTTATAACAAGTTATTTAATTTTCTTTTTGTAAATGTTAAATAGCAATTCAGGAATAATTGAAAAGTGTAAAAACAAATGCATTTTTATATTATTATATTGCTCAATAACTATATTAAAATCAATTTGCTCCAACTTAAATAACAATATATATGTATTCCTTTTTTCCTGTGCTTTACAGACTCATCCGTTCTGTGAAATACTATCTGGAAAAAGACCTGCAGGACAAATTTCAGGCTGAGCATATTGATGATTTCTGCTCTCTTCTCACCAACACATCACCTGATTTAAATGAAGGAAATTCAAGCTTTAAATA[T/A]TCCGGGTAAGATAAGAAAACATGTTTCTGTGGAAAATGTACTTCAGATCTAATTTTACTTTAGGAATGCATTTGAATATCAAATCCCCTATTTGATATTCATTTCACAAACCTATTTCGTTTCACTATTTCCAGAGCTGCAGTGACTCCTGAGGAGTGGGAGAGCCTGTGCAACTTAAACATTAGCAAAGCCGAGAAGGAGAAGAACAACTCTCTTTCTCTGAGAGCTCTTGTGGACAGCCTGCTGGAGCAGACAGCCAGAGACATGCGCAGACAGTACGAGACCACTGGAAGAGCATTTGATCTGCGTATAGAGGAGACCAAAACTGCTAAAGAACAGCTTGAGAACCAGCTCAATGAGGTGAATTCCATCATCACAACACTATATATAGTATACACATTTTTATGTTGAGATATAGGCTAAATGTTATATTTAAATGTGAACTGGAAGTACTTTTATTTCAGTATGTTGATGTCCTTCCAAATGAAATAGAATATTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28498
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041590 Essential Splice Site 205 398 5 8
Genomic Location (Zv9):
Chromosome 15 (position 32001617)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34014930
GRCz11 15 33872909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACATCACCTGATTTAAATGAAGGAAATTCAAGCTTTAAATATTCCGG[G/T]TAAGATAAGAAAACATGTTTCTGTGGAAAATGTACTTCAGATCTAATTTT
Long Flanking Sequence:
TAAATAATAAAATTATAAATTGTTATCAAATTGTCAAATTACAATCAATTATCAGTATTTAAAAAACTTATAAAACAATTTAAATGAATGAATCAAATAATAAATAATCAACATTTTTTCAGATGTTACAAAATAATAATAATGAATACATAAACAATTTATTGAGAATTCATTCATAATTTATAACAAGTTATTTAATTTTCTTTTTGTAAATGTTAAATAGCAATTCAGGAATAATTGAAAAGTGTAAAAACAAATGCATTTTTATATTATTATATTGCTCAATAACTATATTAAAATCAATTTGCTCCAACTTAAATAACAATATATATGTATTCCTTTTTTCCTGTGCTTTACAGACTCATCCGTTCTGTGAAATACTATCTGGAAAAAGACCTGCAGGACAAATTTCAGGCTGAGCATATTGATGATTTCTGCTCTCTTCTCACCAACACATCACCTGATTTAAATGAAGGAAATTCAAGCTTTAAATATTCCGG[G/T]TAAGATAAGAAAACATGTTTCTGTGGAAAATGTACTTCAGATCTAATTTTACTTTAGGAATGCATTTGAATATCAAATCCCCTATTTGATATTCATTTCACAAACCTATTTCGTTTCACTATTTCCAGAGCTGCAGTGACTCCTGAGGAGTGGGAGAGCCTGTGCAACTTAAACATTAGCAAAGCCGAGAAGGAGAAGAACAACTCTCTTTCTCTGAGAGCTCTTGTGGACAGCCTGCTGGAGCAGACAGCCAGAGACATGCGCAGACAGTACGAGACCACTGGAAGAGCATTTGATCTGCGTATAGAGGAGACCAAAACTGCTAAAGAACAGCTTGAGAACCAGCTCAATGAGGTGAATTCCATCATCACAACACTATATATAGTATACACATTTTTATGTTGAGATATAGGCTAAATGTTATATTTAAATGTGAACTGGAAGTACTTTTATTTCAGTATGTTGATGTCCTTCCAAATGAAATAGAATATTGAACAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42585
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041590 Essential Splice Site 205 398 6 8
Genomic Location (Zv9):
Chromosome 15 (position 32001490)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34015057
GRCz11 15 33873036
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCCCTATTTGATATTCATTTCACAAACCTATTTCGTTTCACTATTTCC[A/T]GAGCTGCAGTGACTCCTGAGGAGTGGGAGAGCCTGTGCAACTTAAACATT
Long Flanking Sequence:
ACAAAATAATAATAATGAATACATAAACAATTTATTGAGAATTCATTCATAATTTATAACAAGTTATTTAATTTTCTTTTTGTAAATGTTAAATAGCAATTCAGGAATAATTGAAAAGTGTAAAAACAAATGCATTTTTATATTATTATATTGCTCAATAACTATATTAAAATCAATTTGCTCCAACTTAAATAACAATATATATGTATTCCTTTTTTCCTGTGCTTTACAGACTCATCCGTTCTGTGAAATACTATCTGGAAAAAGACCTGCAGGACAAATTTCAGGCTGAGCATATTGATGATTTCTGCTCTCTTCTCACCAACACATCACCTGATTTAAATGAAGGAAATTCAAGCTTTAAATATTCCGGGTAAGATAAGAAAACATGTTTCTGTGGAAAATGTACTTCAGATCTAATTTTACTTTAGGAATGCATTTGAATATCAAATCCCCTATTTGATATTCATTTCACAAACCTATTTCGTTTCACTATTTCC[A/T]GAGCTGCAGTGACTCCTGAGGAGTGGGAGAGCCTGTGCAACTTAAACATTAGCAAAGCCGAGAAGGAGAAGAACAACTCTCTTTCTCTGAGAGCTCTTGTGGACAGCCTGCTGGAGCAGACAGCCAGAGACATGCGCAGACAGTACGAGACCACTGGAAGAGCATTTGATCTGCGTATAGAGGAGACCAAAACTGCTAAAGAACAGCTTGAGAACCAGCTCAATGAGGTGAATTCCATCATCACAACACTATATATAGTATACACATTTTTATGTTGAGATATAGGCTAAATGTTATATTTAAATGTGAACTGGAAGTACTTTTATTTCAGTATGTTGATGTCCTTCCAAATGAAATAGAATATTGAACAGGGGGCGGGGCTTTCTGTTTGCACATCAAACTAATGGTGAGAGGGGTGTAGTTAGGAATAGTGTGCCTGACGCTGTCAAATTGACGTCAACAGAAATGTGGAACTTCAAATGAGACGTCAACTCCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14123
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041590 Nonsense 367 398 8 8
Genomic Location (Zv9):
Chromosome 15 (position 31996482)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34020065
GRCz11 15 33878044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTGGAACTCTCAGARTCTGAACTAAAAGCTCTAGCATACAACCARCTG[A/T]GACTGGAAGAGGAGATCCAGGTGAAGACAAACTCCCTGTACATAGACGAG
Long Flanking Sequence:
AAAATGTTATTGATTGGGTTTAGAGAAGGAGGGGGTGGGGGTAATCGGTTGGTAAGTTAATAAGTCAGTCGGTCGACAGTGTCTTCTGGTGGGTTTACATGAAAACAGCAGGTGCGAATGGCACTCGCAAGAGGAATTGGAATTCTCAAAAAGTATACACAGCGGCCTCTGGTGGATTGGTGAAAACTGCAAACAAACGTAGCTCCTGGAATGTATTTTGCTTTCTTTACAAATGTATATAGGGTTACGTAATCGGAATGAGCCTGTCTTGAAATAGAGATATCTAAATAACAGATCCCAATAGAAGTGAATAGGAAAATAATAAAAACATTGTGAGAACAGAACAACATAATTTATTCAACAAGTGCCAATGTCTATGAATAAAAACTAGTATCTAATTAATTTTAAAAGCATTTCCCCTGTATGTTTCCCCCCTCAGACTGAGCGAGGCTCTGGAACTCTCAGAGTCTGAACTAAAAGCTCTAGCATACAACCAACTG[A/T]GACTGGAAGAGGAGATCCAGGTGAAGACAAACTCCCTGTACATAGACGAGGTGATCTGCCATCAGCTGCGCCAGCATATCACTATACAGAGCTTCTGAACATGTACAATGGAAAAACCTAGTGATGTTTTTAAAACATTTAATGTGTTTAAAAATCTCTAATGGAATGTTTGTTTGTTAAACACAGACATAAAATGCCTGCAAAAATAAATAAATAAATAAATAAATAAAAAATAAAAATGTTTCTTGGTTATATTATGAAAAACATGAATGGATAGATTATTATAATAATAAAAAATAATCATAATATTATATTATACAGAAACATCATTTTAATTTGATATGAAATAATGTCAGTGCTGGCTTCTTTAATTGTTAAGTTGCGCTGTTAATCATGGGAGGCGTTTCAACTGCACACATCTCTATGATAACAGCGTCATTTCTCAAAAGTCAAATGTGATGAAATAAAAGCACCAAATGCATCAAAGACAGGAAACAATC
Associated Phenotype:
Not determined