Busch Lab

ZMP

sf3b4

Ensembl ID:
ENSDARG00000018574
ZFIN ID:
ZDB-GENE-020419-22
Description:
splicing factor 3B subunit 4 [Source:RefSeq peptide;Acc:NP_705947]
Human Orthologue:
SF3B4
Human Description:
splicing factor 3b, subunit 4, 49kDa [Source:HGNC Symbol;Acc:10771]
Mouse Orthologues:
Gm7935, Sf3b4
Mouse Descriptions:
predicted pseudogene 7935 Pseudogene [Source:MGI Symbol;Acc:MGI:3646370]
splicing factor 3b, subunit 4 Gene [Source:MGI Symbol;Acc:MGI:109580]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29155
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004622 Nonsense 9 400 1 5
Genomic Location (Zv9):
Chromosome 19 (position 8046946)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7505485
GRCz11 19 7424410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCTGTACACACGCCGGGGTTCATCATGGCGGCGGGACCGATTTCAGAA[C/T]GAAATCAAGGTATATTTGATAAATTTAACTTTTTAGTGAAATTGTTATGT
Associated Phenotype:
Not determined