Busch Lab

ZMP

stk38

Ensembl ID:
ENSDARG00000018516
ZFIN ID:
ZDB-GENE-081031-2
Description:
Novel protein similar to H.sapien STK38, serine/threonine kinase 38 (STK38) [Source:UniProtKB/TrEMBL
Human Orthologue:
STK38
Human Description:
serine/threonine kinase 38 [Source:HGNC Symbol;Acc:17847]
Mouse Orthologue:
Stk38
Mouse Description:
serine/threonine kinase 38 Gene [Source:MGI Symbol;Acc:MGI:2442572]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11837 Nonsense Available for shipment Available now
sa13697 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11837
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023186 Nonsense 264 469 8 12
ENSDART00000140588 Nonsense 264 468 9 13
ENSDART00000023186 Nonsense 264 469 8 12
ENSDART00000140588 Nonsense 264 468 9 13
Genomic Location (Zv9):
Chromosome 22 (position 872805)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 875717
GRCz11 22 892615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAATTATGTATTTAATGAACMATTCTCGTAGCGTTTCAGCATATGAACT[C/A]GAAGAGGAAGGCCGAGACATGGAAGAGGAATCGCAGACAGCTRGTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13697
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023186 Nonsense 264 469 8 12
ENSDART00000140588 Nonsense 264 468 9 13
ENSDART00000023186 Nonsense 264 469 8 12
ENSDART00000140588 Nonsense 264 468 9 13
Genomic Location (Zv9):
Chromosome 22 (position 872805)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 875717
GRCz11 22 892615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAATTATGTATTTAATGAACMATTCTCGTAGCGTTTCAGCATATGAACT[C/A]GAAGAGGAAGGCCGAGACATGGAAGAGGAATCGCAGACAGCTRGTCAGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4976
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023186 Nonsense 412 469 11 12
ENSDART00000140588 Nonsense 412 468 12 13
Genomic Location (Zv9):
Chromosome 22 (position 875792)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 878704
GRCz11 22 895602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCCATTACCATCGAGATCAAGAGCATCGACGACACGTCCAACTTCGAC[G/T]AGTTTCCAGATTCGGACATCCTGCAGCCAAMAAGTAAGACGCAGTAAAAA
Associated Phenotype:
Not determined