Busch Lab

ZMP

pdia4

Ensembl ID:
ENSDARG00000018491
ZFIN ID:
ZDB-GENE-030131-5493
Description:
protein disulfide-isomerase A4 [Source:RefSeq peptide;Acc:NP_956073]
Human Orthologue:
PDIA4
Human Description:
protein disulfide isomerase family A, member 4 [Source:HGNC Symbol;Acc:30167]
Mouse Orthologue:
Pdia4
Mouse Description:
protein disulfide isomerase associated 4 Gene [Source:MGI Symbol;Acc:MGI:104864]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44116 Nonsense Mutation detected in F1 DNA Not yet available
sa13170 Nonsense Available for shipment Available now
sa37857 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44116
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018868 Nonsense 98 642 3 10
ENSDART00000081851 None None 228 None 4
ENSDART00000018868 Nonsense 98 642 3 10
ENSDART00000081851 None None 228 None 4

The following transcripts of ENSDARG00000018491 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 17884682)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17191158
GRCz11 24 17335577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATTACACTTTTTCAGGTGTGGCCACTGCAAACAGTTTGCTCCCGAGTA[T/A]GAAAAGATCGCTCAGACGCTGAAGGAAAATGACCCACCTATTCCAGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13170
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018868 Nonsense 98 642 3 10
ENSDART00000081851 None None 228 None 4
ENSDART00000018868 Nonsense 98 642 3 10
ENSDART00000081851 None None 228 None 4

The following transcripts of ENSDARG00000018491 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 17884682)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17191158
GRCz11 24 17335577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATTACACTTTTTCAGGTGTGGCCACTGCAAACAGTTTGCTCCCGAGTA[T/G]GAAAAGATCGCTCAGACGCWGAAGGAAAATGACCYACCTATTCCAGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37857
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018868 Nonsense 206 642 5 10
ENSDART00000081851 None None 228 None 4

The following transcripts of ENSDARG00000018491 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 17886504)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17192980
GRCz11 24 17337399
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAACTTTTTTGAAAGTACTGCGTTTACATTTAAACAGGTGTGGACACTG[T/A]AAGAGACTTGCACCTGAATATGAAAAGGCTGCTAAAGAGCTCAGCAACCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30075
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018868 Essential Splice Site 504 642 9 10
ENSDART00000081851 Essential Splice Site 90 228 3 4

The following transcripts of ENSDARG00000018491 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 17889739)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17196215
GRCz11 24 17340634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGTTTGACTCCGATGTTCTCCGTAGCTTTGTCATGGCGTTCAAAAAAG[G/A]TAAATAATTGGCTTGTTACATACTATAACTTTTTATAACTTTCCAATTTA
Associated Phenotype:
Not determined