Busch Lab

ZMP

cyp2j26

Ensembl ID:
ENSDARG00000018485
ZFIN ID:
ZDB-GENE-040912-139
Description:
cytochrome P450, family 2, subfamily V, polypeptide 2 [Source:RefSeq peptide;Acc:NP_001009890]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa29363 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16671 Nonsense Available for shipment Available now
sa37031 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa29363
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016501 Essential Splice Site 72 505 None 9
ENSDART00000102913 Essential Splice Site 72 504 None 9
ENSDART00000128897 None None 479 None 11
Genomic Location (Zv9):
Chromosome 20 (position 25582114)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25653417
GRCz11 20 25552507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGTTTTCAACCTGGATACTTCACAACCTCATATTGACTTAACTAAGG[T/A]AATTCTTATTTGTTATTACATGTTGTGATTTGATTTCTTAAATATTCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16671
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016501 Nonsense 88 505 2 9
ENSDART00000102913 Nonsense 88 504 2 9
ENSDART00000128897 Nonsense 64 479 3 11
Genomic Location (Zv9):
Chromosome 20 (position 25584321)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25655624
GRCz11 20 25554714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGATGTCRGACCACTATGGCAACATAWTCAGCTTGCGTCTGGGAAGCY[T/G]AAACACAGTTGTTGTGAACACCTACAGTATGGTGAAGAAAGTTCTTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37031
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016501 Nonsense 348 505 7 9
ENSDART00000102913 Nonsense 348 504 7 9
ENSDART00000128897 Nonsense 323 479 9 11
Genomic Location (Zv9):
Chromosome 20 (position 25586723)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25658026
GRCz11 20 25557116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATATTCATGTGTACAGAAAAGGTCCAGGCAGAAATAGACAAAGTTGTT[G/T]GACGGTATCGCCGACCCAGCATGGATGACAGACCCTGCATGCCATACACT
Associated Phenotype:
Not determined