Busch Lab

ZMP

TFR2 (2 of 2)

Ensembl ID:
ENSDARG00000018406
Description:
transferrin receptor 2 [Source:HGNC Symbol;Acc:11762]
Human Orthologue:
TFR2
Human Description:
transferrin receptor 2 [Source:HGNC Symbol;Acc:11762]
Mouse Orthologue:
Trfr2
Mouse Description:
transferrin receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1354956]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38221 Nonsense Mutation detected in F1 DNA Not yet available
sa30415 Missense, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38221
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093150 None None 547 None 16
ENSDART00000128022 Nonsense 232 428 6 10
Genomic Location (Zv9):
Chromosome Zv9_NA897 (position 5830)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45243834
GRCz11 23 44959774
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTCAGTGTTTATTCTGGCACATATATGAAGTG[G/A]TCAGATACGCACTGTAGCTACTTACAAATGCTAGACCATCTATGAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30415
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093150 Nonsense 352 547 9 16
ENSDART00000128022 Missense 260 428 7 10
Genomic Location (Zv9):
Chromosome Zv9_NA897 (position 4671)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45242675
GRCz11 23 44954731
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTACATTATTTCGTAGGGCTGCACAGTATTTTGCATTGCATTGTCGTTA[T/A]CACCATAGTAGTATATGCAATATTCGTATCGCAGACGTGTAATAATTTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30414
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093150 Nonsense 358 547 9 16
ENSDART00000128022 Missense 266 428 7 10
Genomic Location (Zv9):
Chromosome Zv9_NA897 (position 4653)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45242657
GRCz11 23 44954713
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCACAGTATTTTGCATTGCATTGTCGTTATCACCATAGTAGTATATG[C/A]AATATTCGTATCGCAGACGTGTAATAATTTACATTTATTTTATGCATTGG
Associated Phenotype:
Not determined