Busch Lab

ZMP

LOC569014

Ensembl ID:
ENSDARG00000018342
Human Orthologues:
GGT1, GGT2, GGTLC1, GGTLC2, GGTLC3
Human Descriptions:
gamma-glutamyltransferase 1 [Source:HGNC Symbol;Acc:4250]
gamma-glutamyltransferase 2 [Source:HGNC Symbol;Acc:4251]
gamma-glutamyltransferase light chain 1 [Source:HGNC Symbol;Acc:16437]
gamma-glutamyltransferase light chain 2 [Source:HGNC Symbol;Acc:18596]
gamma-glutamyltransferase light chain 3 [Source:HGNC Symbol;Acc:33426]
Mouse Orthologue:
Ggt1
Mouse Description:
gamma-glutamyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:95706]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6182
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042915 Essential Splice Site 58 574 1 12
Genomic Location (Zv9):
Chromosome 10 (position 43022972)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41736273
GRCz11 10 41658143
KASP Assay ID:
554-4572.1 (used for ordering genotyping assays)
KASP Sequence:
TCAAGGCAGCRGTGGCCACAGATGCTGGAACATGTTCAGAGATCGGCAGG[T/G]TTGAGCTCCGACCTCCTTTATACACTGTAAAAGTTGCTTCCCTCYTGCCT
Long Flanking Sequence:
CTAGCCGAAATAAAACAAATAAGACTTTCTCCAGAAGAAAAAATATTATCAGACATACTGTGAAAATTTCCTTGCTCTGTTAACCATCATTTGGAAAATATTTAAAAAAGAAAAAAATTCAAAGGGGGCTGATAATTCTGACTTCAACTGTATATGCACCTCAGTTTTGCCTATATGTGGCATATATATGCGTATAGGCAGTGTATATACCATCATATATGTGCATATGTGCATATAGGTTTCATATATGCACATATATCCTATAGGTTCTTTCTATGTGGGCTCGTTCTCTAACTTGACATTTTTTTGTTGAATGTTGCAGGAAAATGGTGCAGAAGTCGACAGTTGCGGGTCTTGTTCTGCTGCTGCTGGCTGCCGTCGGGACGTTTCTGGCCGTTTTCTTTTCAGTGCAGGGTAAAAAGGCTTCGTCTGATCCAGAATCGGGCTTCTTCAAGGCAGCAGTGGCCACAGATGCTGGAACATGTTCAGAGATCGGCAGG[T/G]TTGAGCTCCGACCTCCTTTATACACTGTAAAAGTTGCTTCCCTCTTGCCTCTAGATATTCGCCTTGCATCTTAAAAAACAATGTGGGAAACGGATCTTTATTTCTAAGTTTTTAAATTGTTGTTCGTATTTTGATGTATTTTTGTTTCAGTGCAAAAAACATCAGTGTGAGCACATCTATGGAGTCAATCTAGGGCCATATATATATATATAGTTGAAGTTTATTTATTTATTTTTTCCCCTAATTTCTGTTTAACGGAGAGATTTTTTCAGCTCATTTCTAAACATAATAGTTTTAATAACTCATGTCTAATAACTAGATATTTTTCAAGACACTTCTATGCAGCTTAAGGTGACAAGTCACCTTAAGTTGCATAGAAGTGTCTTGAAAAATATGTAGTTAAATAATATTTACTGTCATCATGGCAAAGATAAAATAAATCAGTTAAACTAAATCAGGCTTAATTAGGTTAATTAGGCAGGTTAGGGTAATTAGGCAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7653
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042915 Essential Splice Site 300 574 6 12
Genomic Location (Zv9):
Chromosome 10 (position 43007919)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41721220
GRCz11 10 41643090
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCCGTCCAGCGGTCCAGTGCTTACACTCATGCTGAAYATCCTCAGTGG[T/C]GCGTACRGTACACACTTCAACACTACACTATATCCTGCAGATGTTTATGC
Long Flanking Sequence:
TTGCTATGGCTTAATTGTGGCCCAGATCTGGCAAACAGGAGCGGACCGTTCAAGTGCCATCATTCCATGCGGTGTGTGGGCCAGATGTAAGTGTCTGGTGTGGGCCGGATTTGAGCCACATGAATTTTCCTAACTTCGACTCCAAAACTGATTGGTTGACTAACACCTATATGATAAAACACAACAAACTCAAACACACATCTATAATGTTCACTTCAGACATGATTGACTGCCCATAAGTGCTTTAATCTCTGCCCTTTCTAAGCTTCTGTTGTTCCTCAGGTGTTTTGGTACATTGATTTCTGAATATTTCACATTCCTCTAATTCCTGCATCTGTGTGTGTTGCAGACGGGATCATAACTCTGGCGGACTTGAGAGATTATAGGGCTTTGCTGGATGAATATCCTCCTACTGCTTCTGTGGGTGAATTTACTATGGTGACACCAGACGCTCCGTCCAGCGGTCCAGTGCTTACACTCATGCTGAATATCCTCAGTGG[T/C]GCGTACAGTACACACTTCAACACTACACTATATCCTGCAGATGTTTATGCACACATAAGATTTGTTGTGTCTACAATAACTATTTTGTATGCTAAAGATCATGTTTTGTATGCGCAAGATTGTGTTAACTGCTAACCGTAAGATCAAGGTTTGTGTGTGCAAAATGGCTTGTTGATGCAACTATTTTGCACGCAAAAGATCATGTTTTAAACTCACAAAATGGCTTGTTGCATATATTTGAACAATTTTGCATACAAAAGATCATGTTTTGAGCGTGCAAAATGGCTTGTTGATGTGCATTAAACATTTTGCACGCAAAAGATCATGTTTTAGGTGTGCAAAATGGCTTGTTGCGTTTGCGTTAACTATTTTGCACGCAAAAGATCATGTTCGGAGTGCATAAACTGACTTATTGATGTGCGATAACCATTTTGCGCACATAGGGCCCTATCATACACCCGGCGCAGTGGGGCGCAAGGCGTGGCGCAGTAGTCTTTGGT
Associated Phenotype:
Not determined