Busch Lab

ZMP

taf5

Ensembl ID:
ENSDARG00000018325
ZFIN ID:
ZDB-GENE-051120-180
Description:
transcription initiation factor TFIID subunit 5 [Source:RefSeq peptide;Acc:NP_001032508]
Human Orthologue:
TAF5
Human Description:
TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf5
Mouse Description:
TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38290 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12584 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38290
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015007 Essential Splice Site 147 756 1 11
Genomic Location (Zv9):
Chromosome 1 (position 49922149)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48771330
GRCz11 1 49415750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGGTGCAGCCGCCCCGCAGAGCACACTCACCCCCATACCTGCGAAGAG[T/C]GAGTGACAGCCGCAGACACACACTGATGCTGGGGCATCACTTTTATTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25657
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015007 Essential Splice Site 468 756 7 11
Genomic Location (Zv9):
Chromosome 1 (position 49930853)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48780034
GRCz11 1 49424454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGTCTTGTTTCACTTCAGTGCCAACCATTCTTTTTTTTTTTTTTTTTA[G/A]ACCTGAATTTGATTGATAAAGAGTCAGATGATGTTCTAGAGAGGATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12584
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015007 Nonsense 671 756 10 11
Genomic Location (Zv9):
Chromosome 1 (position 49936394)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48785575
GRCz11 1 49429995
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACACGGGCTGATGATCGCAGAGYTGAAGGGTCACACYGGCACTATTTA[T/A]GCCCTCAAGTTCAGCAGAGATGGAGAAATCATTGCATCAGGTCAGGATTA
Associated Phenotype:
Not determined