Busch Lab

ZMP

bmp7a

Ensembl ID:
ENSDARG00000018260
ZFIN ID:
ZDB-GENE-000208-25
Description:
bone morphogenetic protein 7a [Source:RefSeq peptide;Acc:NP_571396]
Human Orthologue:
BMP7
Human Description:
bone morphogenetic protein 7 [Source:HGNC Symbol;Acc:1074]
Mouse Orthologue:
Bmp7
Mouse Description:
bone morphogenetic protein 7 Gene [Source:MGI Symbol;Acc:MGI:103302]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa1343 Nonsense Available for shipment Available now
sa15764 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1343
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016472 Nonsense 212 432 3 7
ENSDART00000143942 Nonsense 76 296 2 6
Genomic Location (Zv9):
Chromosome 11 (position 7201463)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7104676
GRCz11 11 7114515
KASP Assay ID:
554-1257.1 (used for ordering genotyping assays)
KASP Sequence:
CTTCTGACCCTGCACAGGGAGCTGTACCTGCTGGACTCACGAGTGGTATG[G/A]GCTGCAGAAGAGGGATGGCTGGTCTTTGACCTCACGGTCACCAGTAACCA
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control; 10 hpf
Control; 10 hpf
Mutant; 10 hpf
Mutant; 10 hpf
Control; 10 hpf
Control; 10 hpf
Mutant; 10 hpf
Mutant; 10 hpf
Mutant; 10 hpf
Mutant; 10 hpf
Stage Entity Quality Tag
Segmentation:5-9 somites
ZFS:0000024
whole organism
ZFA:0001094
dorsalized
PATO:0000620
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa15764
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016472 Nonsense 218 432 3 7
ENSDART00000143942 Nonsense 82 296 2 6
Genomic Location (Zv9):
Chromosome 11 (position 7201446)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7104659
GRCz11 11 7114498
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGCTGTACCTGCTGGACTCACGAGTGGTATGRGCTGCAGAAGAGGGAT[G/A]GCTRGTCTTTGACCTCACGGTCACCAGTAACCACTGGGTTATAAACCCAG
Associated Phenotype:
Not determined