Busch Lab

ZMP

atp1a3a

Ensembl ID:
ENSDARG00000018259
ZFIN IDs:
ZDB-GENE-001212-7, ZDB-GENE-001212-8
Description:
ATPase, Na+/K+ transporting, alpha 3a polypeptide [Source:RefSeq peptide;Acc:NP_571759]
Human Orthologue:
ATP1A3
Human Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide [Source:HGNC Symbol;Acc:801]
Mouse Orthologue:
Atp1a3
Mouse Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88107]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36772 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4783
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104950 Nonsense 317 1023 8 21
Genomic Location (Zv9):
Chromosome 19 (position 6974706)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6433381
GRCz11 19 6352412
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTGGGCGTCAYCTTCTTCATCCTGTCCATCATCCTGGGCTACAGCTG[G/A]CTGGAGGCCGTCATCTTCCTCATCGGCATCATYGTGGCCAACGTGCCCGA
Long Flanking Sequence:
ATTTTAAGTCATCATGAAACCAAAATTTGGATTTTTATGTCTACAAATGCCTATGTGTCAGCATAGTGGCAGATTTAAAAACAAGATTAACATCCTGTGCTAGCAAGGGAAAGATTGTCACTAATGGTCGGGGCTTTCACACTCTGATGACACGCACAAAGGGAGAATGTCAATCAAAGTGTTTCTGCAGACTGTTTTCATCCATTGTGATTATAAAAAAAAATAAATATGTATCTTTTACCATTAGAAGCTGGATATATTCACACACTGTTGCCTGACAACTGTGTTTAAATGTCTCCCTCAGGTACTGCTCGCGGTATTGTGGTCTGCACCGGTGACCGCACCGTCATGGGCCGCATCGCCACCCTGACCTCCGGCCTGGAGACCGGAAAGACTCCCATCGCCAAAGAGATCGAGCACTTCATCCACATCATCACCGGCGTGGCCGTCTTCCTGGGCGTCACCTTCTTCATCCTGTCCATCATCCTGGGCTACAGCTG[G/A]CTGGAGGCCGTCATCTTCCTCATCGGCATCATTGTGGCCAACGTGCCCGAGGGGCTGCTGGCCACCGTCACTGTGAGCATCCAACCTTTATTTCACTCTCTGTCTTTCTCACTGTGTCAGGAGTGTGTTTCAGGGTCTTTGTTAGTGTCCTTTTGTGATTATTGTCATGTTTTTCAGTATAATTTGTGAGTTAATATGTGTTTGTCGTTTTCTTGTGTGTATTTTTCGTTTATGGATTTGTTCGGAATCTGGAACACTAACACACTGCAGTATGAACACTACATACTACCTACTGAGGGTTCACAAAGACTATAGAATACACAAGACGTGTCACTCGTATAGTCCTAAATGGGGAAAAGTGTATCGGCCAATAGTAGCTGTGTCATCATAGGAATAACATATATTTTAAAGGTTATTAAATAATAAAATAGGGTTATAAAACATATGCCAGAGTAATTGGCAGTTCATTCCACTGTGGCGACCCCTGTTAAATTAGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36772
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104950 Essential Splice Site 906 1023 17 21
Genomic Location (Zv9):
Chromosome 19 (position 6957571)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6416246
GRCz11 19 6335277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACGATCGCTCCAACAATGACCTGGAGGACAGTTACGGACAGCAATGGG[T/G]AAACATTACATCACATTTCATCTTTGATAGACAAGGATATGCATTTGGCG
Long Flanking Sequence:
AAAAACAACAAGAAGGCAAGACACAGAAAAAGACGCATGCAATACGCAATAAAAAGTTAATAAATAAACTTTAGTCGGAACAGTCTCGCAGTACTGTTTTTGTAAAAAATGACCAAATGACATTTGTCTCCTTCCCTTTTTGGCTGATCTGAAAAATGGTTCAATCCGTGTCTATAAAAAGCATAATGTAATCCGAACCGTCAGATTTGTGATCCGTCACACCACTAATACTTATAATTGGCAGGTAATAAGTTAAACTAAAGTGTTAGCAAACAAACTGATGATGTAAAAGAAAAGCTGGTTTGTTGAGCTGAAATGAAGCCAATAAATGTGACTTTCCATTAAATATGCAGGTATGATTCAGGCGCTGGGAGGATTCTTCAGTTATTTCGTGATTCTGGCTGAGAATGGTTTTCTGCCCAGTGTGCTGGTGGGCATTCGGCTGAACTGGGACGATCGCTCCAACAATGACCTGGAGGACAGTTACGGACAGCAATGGG[T/G]AAACATTACATCACATTTCATCTTTGATAGACAAGGATATGCATTTGGCGTTGGTTTTTCAATAGCAGATCGCATTGCATTTAGTTTATATTTAAATGCATTCATTTAGCAGGTGCTTTTATTTAAAGTGACTTCGCTAACTGTGTACTGTGATATGAGCCAACAGTTTCATTTAATTTTCATTCGGCACAGGCACTAATGTTGGGTTACTTTGGAGAAAAACATTTAATTGGGATAATTTTTTATTTATTATTATTAGTATAGTAGATGTTATTAATTAATAATTAAGTAGTTTTATGTTTTTCCAGGATTTTGTGAGTTATGGAGATGTTAAAGGAAATATTGTATAAGATTTTTTTACTATAATATGAGCCAACAACATTTTCATTTAATTTTCATTTGAAACGCGCTAATGTTTGGTAACTTTGGAGAAACATTTCATTCTCTTATTTTTAATTATTATTATTATTAGTAGGAGTAGTGGTAGTAGTAGTAGTAAT
Associated Phenotype:
Not determined