Busch Lab

ZMP

adkb

Ensembl ID:
ENSDARG00000018258
ZFIN ID:
ZDB-GENE-030131-948
Description:
adenosine kinase b [Source:RefSeq peptide;Acc:NP_942097]
Human Orthologue:
ADK
Human Description:
adenosine kinase [Source:HGNC Symbol;Acc:257]
Mouse Orthologue:
Adk
Mouse Description:
adenosine kinase Gene [Source:MGI Symbol;Acc:MGI:87930]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6276 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4480
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027234 Nonsense 60 345 4 11
ENSDART00000089385 Nonsense 60 345 4 11
Genomic Location (Zv9):
Chromosome 12 (position 47928222)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 46834780
GRCz11 12 46850965
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTTCTGCAGGTTTGATGAGATCGTGAATAAAAGTAAAGTGGAGTA[T/G]CATGCTGGCGGGTCCACACAGAACTCTGTTAAAATCGCACAGGTACGTCT
Long Flanking Sequence:
ATAAAGTGGCCAGTGAGTATAAATTTGAAATATAGTACACAATATAAATGTATAATAAATAGTAAAGTTTTTAGTGTGTTTTTTTCAAATGAAGGTGGGCTTGTTGAGACAAACACTTAAAAGGCGTTAACCAAGTTGAGTGGAGATAAATGGCATAAACACACACACACACACACACACACACCATAGTGTCTATGTATATAGGATGGTCTGAAGTAAACTGTATCTTACAGCTCTAATTATGTCCATGTATAATAAACTACTGTATGATGGATTTGAACAGGACATCGTGAGTATGAAGTATTATATAAACTGAAGCAGTTCGTTTAGTTTATAAATCCAGTGTGTTTATACAGTTACAGTAATCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCTGCAGGTTTGATGAGATCGTGAATAAAAGTAAAGTGGAGTA[T/G]CATGCTGGCGGGTCCACACAGAACTCTGTTAAAATCGCACAGGTACGTCTGACGAAGAAAATGTCTGTTTCATATCAGCGAAAGCATTTACAGCAGCAGTAATTAATAGTTTTCAGTCATGTGACCTGTGTGGAGACCTGGCGGGCAGAAAAGCAATGAGCCATAATGGCGGCTGCACTGAAATTTCCCTAGAAACGCTGAAAAATCAGCTCAGTTTTCCATCTGTTTTAAGCTACCAATATTTGTATCACATATCAACAGAAATAAACAGAGATATGATCACAAACTGGGAATTGTAGGCACTTGTGATTCATATACTTCATTTGAAACCCTAATTTTCCTAATTCAGCCATGCTTACATCTATTTTGTGGATGTTATTCCTCAGAGATTTAGGTCCAAAGCCAATTCTGTTTTGTGATGGTGTATTCTGGAAAATTTTTGTACCCCTTGGTGTTGGGTGTGGTTCTGAAAAGTCTGTTTCAAGGACTATCCAACCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6276
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027234 Nonsense 113 345 5 11
ENSDART00000089385 Nonsense 113 345 5 11
Genomic Location (Zv9):
Chromosome 12 (position 47930257)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 46836815
GRCz11 12 46853000
KASP Assay ID:
554-5097.1 (used for ordering genotyping assays)
KASP Sequence:
GAGATCCTGARGCAGAAAGCAGCTGAAGCTCAYGTTGAYGCTCATTATTA[T/A]GAACAAAATCAASAACCCACAGGAACCTGTGCGGCCTGCATTACTGGAGA
Long Flanking Sequence:
CATTTCTGATAACAGATTTAATTTATCTTTGCCATGATGACACTTCTACACAGCTTAAAGTGACATTTAAAGGCTTCACTAGGTTAATTAGGGTAAAGTTCGGGTAATTAGGCAAGTCATTGTATAACAGTGGTTTGCTCTGGAGACAATCCAAAGCTAATATTGCTTAAGGGGGCTAATAATATTGACCTTAAAATGGGTTTAATAAAATTAAAAATGACTTTTATTCTAGCCGAAATAAAACAAATAAGACTTTCTCCAGAAGAAAAAATATTATAGGAAATACTGTGAAAAATTCCTGAATCTGTTCAACATCATTTGGGAAACATTCACAGTAGGGCGAATAATTCTGACTTCACCTGTATGTGTGATTTCTGCTGTCAGTGGATGATCCAGGAGCCGCATAAAGTGGCCACGTTCTTCGGCTGCATCGGGACGGATCATTTCGGGGAGATCCTGAAGCAGAAAGCAGCTGAAGCTCACGTTGATGCTCATTATTA[T/A]GAACAAAATCAAGAACCCACAGGAACCTGTGCGGCCTGCATTACTGGAGACAACAGGTCAGAAAACACATCACATTATAGCTCAACACGGCTGTGTTTCTGTCAACAAATATGCTGTAAAAAGGGGGAATATTATTATAATTCAAAATAGCTGTTGTCTAAATTACTGCATTTTAAAATCGAATTTATTTCTGTGATGTAAAGCTGAATTTTCAGCATCATTACTCCAGTCTTCAGTCTCTCATAATTCTCATTCAATTTAATATGGGGATTTTTAGGATTCTTTGATATGTTGAAAGGTTGAACAGGATTTATTTGATATTGAAATCTTTAGTAAATCTTTAGTACAAATGTATTTTCCTCCTTGTTATTATCACAGATTTTTTTAGAAATGAATGCATCCTTGATTTTATTTGATTTTCCCATATTAAGAAAAATCTGAGTCAGGTAAACCAAAAACCTCATAACTCAAGCTATTTTTGTTACTTTGAATAAAACAAT
Associated Phenotype:
Not determined